Cart 3 Product Products 328,22 € (empty)
-
-
-
1 x CRK-v-crk...113,40 €
No products
To be determined Shipping
328,22 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 328,22 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 328,22 €
Data sheet of NUP35-nucleoporin 35kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUP35-nucleoporin 35kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047029 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUP35 |
| Origin species: | Human |
| Product name: | NUP35-nucleoporin 35kDa Gene |
| Size: | 2ug |
| Accessions: | BC047029 |
| Gene id: | 129401 |
| Gene description: | nucleoporin 35kDa |
| Synonyms: | MP-44; MP44; NP44; NUP53; nucleoporin NUP53; mitotic phosphoprotein 44; nuclear pore complex protein Nup53; nucleoporin 35kDa; nucleoporin 35 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagcctttgcagtggaacctcaggggcccgcgttaggatctgaaccaatgatgctgggttcacccacatctccaaagccaggagttaatgcccagttcttacctggatttttaatgggggatttgccagctccggtgactccacaacctcgatcaattagtggcccttcagtaggagtaatggaaatgagatcacctttacttgcaggtgggtcaccaccacaaccagttgtaccagctcataaagataaaagtggcgctccaccagttagaagtatatatgatgacatttctagcccaggacttggatcaacacctttaacttcaagaagacagccaaacatttcagtaatgcagagtcctcttgttggagttacatctactcctggaacagggcaaagtatgtttagtccagcaagtatcggtcagccacgaaagacgacattatctcctgcccagttggatcctttttatactcaaggagattctttgacttcagaagatcacctcgatgactcttgggtgactgtatttgggtttcctcaagcatctgcttcctacatattactacaatttgcacagtatgggaatatcttaaaacatgtgatgtctaatacaggaaattggatgcatattcgttatcaatctaaactgcaggctcggaaagccttaagcaaagatgggaggatttttggagaatccatcatgattggtgtaaaaccatgtattgacaaaagtgttatggaaagcagtgacagatgtgctttatcatctccatctttagcctttacaccaccaatcaaaactctaggtacaccaacacaacctggaagtactcctaggatttctaccatgagacctcttgctacagcatacaaagcctctactagtgattatcaggttatttctgacagacaaacgccaaaaaaagatgaaagtcttgtatccaaagcaatggagtacatgtttggctggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nucleoporin 62kDa - attractin-like 1 - F-box protein 38 - ferredoxin 1-like |