PTXBC040036
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC040036 |
Product type: | DNA & cDNA |
Ncbi symbol: | C17orf49 |
Origin species: | Human |
Product name: | C17orf49-chromosome 17 open reading frame 49 Gene |
Size: | 2ug |
Accessions: | BC040036 |
Gene id: | 124944 |
Gene description: | chromosome 17 open reading frame 49 |
Synonyms: | MLL1/MLL complex subunit C17orf49; BAP18; HEPIS; chromatin complexes subunit BAP18; BPTF-associated protein of 18 kDa; human embryo lung cellular protein interacting with SARS-CoV nsp-10; chromosome 17 open reading frame 49 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgacgtcagcgtccacaaaggtcggagagatcttctcggcggccggcgccgccttcacgaagctcggggagctgacgatgcagctgcatcccgtggccgactcttctcctgcgggcgcgaagtggacggagacggaaatagagatgctgagggctgctgtgaagcgatttggggacgatcttaatcacatcagctgtgtcatcaaggaacggacagtggcccagataaaggccactgtgaaacgcaaggtatatgaagattctggcatcccccttccagctgagtcacccaagaaagggcccaagaaggtggcatctggtgtcttgtcacctcctccagctgcccctcctcccagcagctccagtgtccctgaggccgggggtccccccataaagaaacagaaggctgatgtgacactcagtgctctgaacgactccgatgccaacagtgacgtggtggatattgaagggctaggagaaactcctccagctaagaaactcaacttcgaccaggcctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - chromosome 16 open reading frame 65 - chromosome 11 open reading frame 53 - chromosome 12 open reading frame 10 - dishevelled, dsh homolog 1 (Drosophila) |