Cart 3 Product Products 356,40 € (empty)
-
1 x ANKRD44-an...121,50 € -
1 x MOBP-myeli...113,40 € -
1 x CYTIP-cyto...121,50 €
No products
To be determined Shipping
356,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 356,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 356,40 €
View larger 
PTRH1-peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) Gene
PTXBC047012
New product
Data sheet of PTRH1-peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTRH1-peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047012 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTRH1 |
| Origin species: | Human |
| Product name: | PTRH1-peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC047012 |
| Gene id: | 138428 |
| Gene description: | peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) |
| Synonyms: | C9orf115; PTH1; PTH; peptidyl-tRNA hydrolase 1 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggccgggcggctttttgggcgccggacagcggctgagtagagccatgagccgatgtgttttggagcctcgccccccggggaagcggtggatggtggctggcctggggaatcccggactgcccggcacgcgacacagcgtgggcatggcggtgctggggcagctggcgcggcggctgggtgtggcggagagttggacgcgcgaccggcactgtgccgccgacctcgccctggccccgctgggggatgcccaactggtcctgctccggccacggcggcttatgaacgccaacgggcgcagcgtggcccgggctgcggagctgtttgggctgactgccgaggaagtctacctggtgcatgatgagctggacaagcccctggggagactggctctgaagctggggggcagtgccaggggccacaatggagtccgttcctgcattagctgcctcaactccaatgcaatgccaaggctgcgggtgggtatcgggcgcccggcgcaccctgaggcggttcaggcccatgtgctgggctgcttctcccctgctgagcaggagctgctgcctctgttgctggatcgagccaccgacctgatcttggaccacatccgtgagcgaagccaggggccctcactggggccgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ectonucleoside triphosphate diphosphohydrolase 1 - 3'-phosphoadenosine 5'-phosphosulfate synthase 1 - fumarylacetoacetate hydrolase domain containing 1 - ELK4, ETS-domain protein (SRF accessory protein 1) |