> >>CGGBP1-CGG triplet repeat binding protein 1 Gene
CGGBP1-CGG triplet repeat binding protein 1 Gene View larger

CGGBP1-CGG triplet repeat binding protein 1 Gene

PTXBC052980

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of CGGBP1-CGG triplet repeat binding protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CGGBP1-CGG triplet repeat binding protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC052980
Product type: DNA & cDNA
Ncbi symbol: CGGBP1
Origin species: Human
Product name: CGGBP1-CGG triplet repeat binding protein 1 Gene
Size: 2ug
Accessions: BC052980
Gene id: 8545
Gene description: CGG triplet repeat binding protein 1
Synonyms: CGGBP; p20-CGGBP; CGG triplet repeat-binding protein 1; 20 kDa CGG-binding protein; CGG-binding protein 1; p20-CGG binding protein; p20-CGGBP DNA-binding protein; CGG triplet repeat binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcgatttgtagtaacagcaccacctgctcgaaaccgttctaagactgctttgtatgtgactcccctggatcgagtcactgagtttggaggtgagctgcatgaagatggaggaaaactcttctgcacttcttgcaatgtggttctgaatcatgttcgcaagtctgccattagtgaccacctcaagtcaaagactcataccaagaggaaggcagaatttgaagagcagaatgtgagaaagaagcagaggcccctaactgcatctcttcagtgcaacagtactgcgcaaacagagaaagtcagtgttatccaggactttgtgaaaatgtgcctggaagccaacatcccacttgagaaggctgatcacccagcagtccgtgctttcctatctcgccatgtgaagaatggaggctccatacctaagtcagaccagctacggagggcatatcttcctgatggatatgagaatgagaatcaactcctcaactcacaagattgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - IQ motif containing with AAA domain 1
- transmembrane 6 superfamily member 1
- single stranded DNA binding protein 3
- tigger transposable element derived 1

Reviews

Buy CGGBP1-CGG triplet repeat binding protein 1 Gene now

Add to cart