Cart 2 Product Products 225,44 € (empty)
-
1 x PYCR1-pyrr...113,40 € -
No products
To be determined Shipping
225,44 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 225,44 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 225,44 €
Data sheet of RNF144A-ring finger protein 144A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNF144A-ring finger protein 144A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC050373 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNF144A |
| Origin species: | Human |
| Product name: | RNF144A-ring finger protein 144A Gene |
| Size: | 2ug |
| Accessions: | BC050373 |
| Gene id: | 9781 |
| Gene description: | ring finger protein 144A |
| Synonyms: | E3 ubiquitin-protein ligase RNF144A; RNF144; UBCE7IP4; UbcM4-interacting protein 4; ring finger protein 144; ubiquitin conjugating enzyme 7 interacting protein 4; ring finger protein 144A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccacagcaaggtaccggcccacctgggacctggccctcgacccgctggtgtcttgcaagctctgtcttggggagtacccagtggagcagatgacaaccatagcccagtgccaatgcatcttctgtactctgtgcctgaaacagtatgttgagctcttgatcaaagaaggattagaaaccgcaattagctgcccagatgctgcctgccctaaacagggccacctacaggagaacgagattgagtgcatggttgcagctgaaattatgcaaagatataaaaagctacaatttgaaagagaggtgctgtttgatccctgtcggacttggtgcccggcgtccacctgccaagctgtgtgtcagctccaggacgtggggctgcagaccccccagccagtgcagtgcaaagcctgccgtatggaattctgctccacctgcaaagccagctggcaccctggccagggctgcccggagaccatgccgatcaccttcctccccggggagaccagtgctgctttcaaaatggaagaagatgacgcgcccatcaagcgctgccccaagtgcaaagtctacatcgagcgagacgaaggctgcgcgcagatgatgtgcaagaactgcaagcacgccttctgctggtactgcctggagtctctggacgatgatttccttctgatacactacgataagggaccctgccggaacaagctgggccactcccgggcatctgtgatctggcatcggacacaggttgtgggcatttttgcaggatttgggctgctgctcttggtggcctcacctttcctactcctggccactccctttgtactttgctgcaagtgcaagtgcagtaaaggtgacgacgacccgttacccacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger protein 322A - kinesin family member 16B - matrix metallopeptidase 19 - RNA binding motif protein 6 |