Cart 28 Product Products 3 495,32 € (empty)
-
1 x HSPB2-heat...113,40 € -
1 x KMO-kynure...121,50 € -
-
1 x PCGF6-poly...121,50 € -
-
1 x SELV-selen...121,50 € -
1 x DNAJC1-Dna...121,50 € -
1 x CHMP1A-chr...113,40 € -
-
1 x LOC152225-...113,40 € -
1 x FBXO6-F-bo...121,50 € -
1 x C21orf56-c...113,40 € -
1 x VPS29-vacu...113,40 € -
1 x SPATA4-spe...121,50 € -
-
1 x ELK1-ELK1,...121,50 € -
1 x C21orf58-c...113,40 € -
1 x P2RY5-puri...121,50 € -
-
-
1 x STK19-seri...121,50 € -
1 x DEFB105A-d...113,40 € -
1 x SCYL1BP1-S...113,40 € -
1 x EEF1G-euka...121,50 € -
1 x MS4A5-memb...113,40 € -
1 x Anti-Proli...405,46 € -
1 x NUBP1-nucl...121,50 € -
No products
To be determined Shipping
3 495,32 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 28 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 495,32 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 495,32 €
Data sheet of MBNL3-muscleblind-like 3 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MBNL3-muscleblind-like 3 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC042090 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MBNL3 |
| Origin species: | Human |
| Product name: | MBNL3-muscleblind-like 3 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC042090 |
| Gene id: | 55796 |
| Gene description: | muscleblind-like 3 (Drosophila) |
| Synonyms: | CHCR; MBLX; MBLX39; MBXL; muscleblind-like protein 3; Cys3His CCG1-required protein; muscleblind-like 3; muscleblind-like X-linked protein; muscleblind like splicing regulator 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcgcccagcagatgcagcttatgctccaaaacgctcaaatgtcatcacttggttcttttcctatgactccatcaattccagctaatcctcccatggctttcaatccttacataccacatcctgggatgggcctcgttcctgcagaacttgtaccaaatacacctgttctgattcctggaaacccacctcttgcaatgccaggagctgttggcccaaaactgatgcgttcagataaactggaggtttgccgagaatttcagcgtggaaattgtacccgtggggagaatgattgccgctatgctcaccctactgatgcttccatgattgaagcgagtgataatactgtgacaatctgcatggattacatcaaaggtcgatgctcgcgggagaaatgcaagtactttcatcctcctgcacacttgcaagccagactcaaggcagctcatcatcagatgaaccattcagctgcctctgccatggccctgcagcctggtacactgcaactgataccaaagagatcagcactggaaaagcccaatggtgccaccccggtctttaatcccactgttttccactgccaacaggctctgactaacctgcagctcccacagccggcatttatccctgcagggccaatactgtgcatggcacccgcttcaaatattgtgcccatgatgcacggtgctacacctaccactgtgtctgcagcaacaacacctgccaccagcgttccgttcgctgcaccaactacaggcaatcagctgaaattctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - abhydrolase domain containing 7 - SAM and SH3 domain containing 3 - RAS-like, family 10, member A - ubiquitin specific peptidase 15 |