Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMA2-proteasome (prosome, macropain) subunit, alpha type, 2 Gene
PTXBC047697
New product
Data sheet of PSMA2-proteasome (prosome, macropain) subunit, alpha type, 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMA2-proteasome (prosome, macropain) subunit, alpha type, 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047697 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMA2 |
| Origin species: | Human |
| Product name: | PSMA2-proteasome (prosome, macropain) subunit, alpha type, 2 Gene |
| Size: | 2ug |
| Accessions: | BC047697 |
| Gene id: | 5683 |
| Gene description: | proteasome (prosome, macropain) subunit, alpha type, 2 |
| Synonyms: | HC3; PMSA2; PSC2; proteasome subunit alpha type-2; macropain subunit C3; multicatalytic endopeptidase complex subunit C3; proteasome (prosome, macropain) subunit, alpha type, 2; proteasome component C3; proteasome subunit HC3; proteasome subunit alpha 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggagcgcgggtacagcttttcgctgactacattcagcccgtctggtaaacttgtccagattgaatatgctttggctgctgtagctggaggagccccgtccgtgggaattaaagctgcaaatggtgtggtattagcaactgagaaaaaacagaaatccattctgtatgatgagcgaagtgtacacaaagtagaaccaattaccaagcatataggtttggtgtacagtggcatgggccccgattacagagtgcttgtgcacagagctcgaaaactagctcaacaatactatcttgtgtaccaagaacccattcctacagctcagctggtacagagagtagcttctgtgatgcaagaatatactcagtcaggtggtgttcgtccatttggagtttctttacttatttgtggttggaatgagggacgaccatatttatttcagtcagatccatctggagcttactttgcctggaaagctacagcaatgggaaagaactatgtgaatgggaagactttccttgagaaaagatataatgaagatctggaacttgaagatgccattcatacagccatcttaaccctaaaggaaagctttgaagggcaaatgacagaggataacatagaagttggaatctgcaatgaagctggatttaggaggcttactccaactgaagttaaggattacttggctgccatagcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tRNA splicing endonuclease 54 homolog (S. cerevisiae) - vacuolar protein sorting 37 homolog D (S. cerevisiae) - hepatocyte growth factor (hepapoietin A; scatter factor) - pyridoxal-dependent decarboxylase domain containing 2 |