PTXBC047704
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC047704 |
Product type: | DNA & cDNA |
Ncbi symbol: | SPATA3 |
Origin species: | Human |
Product name: | SPATA3-spermatogenesis associated 3 Gene |
Size: | 2ug |
Accessions: | BC047704 |
Gene id: | 130560 |
Gene description: | spermatogenesis associated 3 |
Synonyms: | 1700011N12Rik; 1700029H01Rik; 4930424D10Rik; Mtsarg1; Tsarg1; spermatogenesis-associated protein 3; testis and spermatogenesis cell apoptosis related gene 1; testis and spermatogenesis cell apoptosis related protein 1; testis and spermatogenesis cell-related protein 1; testis spermatocyte apoptosis-related protein 1; spermatogenesis associated 3 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaagaaggtcaagaagaaaaggtcagaggccagacgccaccgagactccacctcccagcatgctagctccaattccacctctcagcagcctagtcctgaatccacaccacagcagcctagccctgaatccacaccacagcattccagccttgaaaccacctcccggcagccagcattccaagcccttccagcacccgaaatccgccgctcctcttgctgccttttatctccagatgctaacgtgaaggcagcccctcaatccaggaaagcagggcctctgactcgcgccggcccgcattcctgctcctgtgccacttgcccctgcagctccgcttgctggcgtcgtctggggctatgccatagccgcatcttcgatgtccttctgcctcgggactggcagatggcgccagggagaggactccccaacctgctcaccttctacagaaaatcttcaagaaaaccctccagtcatcgtaacgcgtgtcctccaagccctcggaactgtggctgtggctctgggggctctaggagctgcctactacatcactga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - TBC1 domain family, member 7 - muscleblind-like (Drosophila) - FCH and double SH3 domains 1 - transmembrane protein 120A |