Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CPSF4-cleavage and polyadenylation specific factor 4, 30kDa Gene
PTXBC050738
New product
Data sheet of CPSF4-cleavage and polyadenylation specific factor 4, 30kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CPSF4-cleavage and polyadenylation specific factor 4, 30kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC050738 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CPSF4 |
| Origin species: | Human |
| Product name: | CPSF4-cleavage and polyadenylation specific factor 4, 30kDa Gene |
| Size: | 2ug |
| Accessions: | BC050738 |
| Gene id: | 10898 |
| Gene description: | cleavage and polyadenylation specific factor 4, 30kDa |
| Synonyms: | CPSF30; NAR; NEB-1; NEB1; cleavage and polyadenylation specificity factor subunit 4; CPSF 30 kDa subunit; NS1 effector domain-binding protein 1; cleavage and polyadenylation specific factor 4, 30kDa; cleavage and polyadenylation specificity factor 30 kDa subunit; no arches homolog; no arches-like zinc finger protein; cleavage and polyadenylation specific factor 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaggaaatcatcgccagcgtggaccacatcaagtttgacttggagatcgcggtggagcagcagctgggggcgcagccgctgcccttccccggcatggacaagtcgggcgctgctgtctgtgaattctttttgaaagctgcctgcggcaaagggggcatgtgtccgtttcgccacatcagtggtgagaagacagttgtgtgcaaacactggctgcgtggcctatgcaagaaaggggaccagtgtgagttcctgcatgagtatgacatgaccaagatgcccgagtgctacttctactccaagttcggggagtgcagcaacaaggaatgtcccttcctgcacatcgaccccgagtccaagatcaaggactgtccttggtatgaccgcggcttctgcaagcacggtcccctctgcaggcaccggcacacacggagagtcatctgtgtgaattacctcgtgggattctgcccggaggggccctcgtgtaaattcatgcaccctcgatttgaactgcccatgggaaccaccgagcagcccccactgccacagcagacacagcctccagcaaagagaaccccgcaggtcatcggggtcatgcagagtcaaaacagcagcgcgggcaaccggggaccccggccactggagcaggtcacctgttacaagtgtggcgagaaaggacactacgccaacagatgcaccaaagggcacttggcctttctcagtggacagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - feline leukemia virus subgroup C cellular receptor 1 - cytoplasmic polyadenylation element binding protein 1 - coenzyme Q3 homolog, methyltransferase (S. cerevisiae) - leucine rich repeat (in FLII) interacting protein 2 |