Cart 4 Product Products 1 235,75 € (empty)
-
-
1 x ANKHD1-ank...121,50 € -
1 x ABI2-abl...121,50 € -
No products
To be determined Shipping
1 235,75 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 235,75 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 235,75 €
Data sheet of OLAH-oleoyl-ACP hydrolase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OLAH-oleoyl-ACP hydrolase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC050372 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OLAH |
| Origin species: | Human |
| Product name: | OLAH-oleoyl-ACP hydrolase Gene |
| Size: | 2ug |
| Accessions: | BC050372 |
| Gene id: | 55301 |
| Gene description: | oleoyl-ACP hydrolase |
| Synonyms: | AURA1; SAST; THEDC1; S-acyl fatty acid synthase thioesterase, medium chain; augmented in rheumatoid arthritis 1; oleoyl-acyl-carrier-protein hydrolase; thioesterase II; thioesterase domain containing 1; thioesterase domain-containing protein 1; oleoyl-ACP hydrolase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagagaggagaccaacctaagagaaccaggaatgaaaacattttcaactgcttatacaaaaaccctgaggcaacttttaagctgatttgctttccctggatgggaggtggctccactcattttgccaaatggggccaagatactcatgatttgctggaagtgcactccttaaggcttcctggaagagaaagcagagttgaagaacctcttgaaaatgacatctcccagttagttgatgaagttgtttgtgctctgcagccagtcatccaggataaaccatttgcattttttggccacagtatgggatcctacattgcttttaggactgcactaggtctaaaagaaaacaatcaaccagaaccattgcatttatttttgtcaagtgcaactcctgtacattcaaaggcctggcatcgcattcccaaagatgatgaattgtcagaagaacaaataagtcattaccttatggaatttggaggcacccccaagcattttgctgaagccaaggaatttgtgaaacaatgtagtcccatcataagggcagatctgaacattgttagaagttgcacctctaacgtaccatctaaggctgttctttcctgtgacttgacatgttttgttggatctgaagacatagcaaaggacatggaagcctggaaagatgtaaccagtggaaatgctaaaatttaccagcttccagggggtcacttttatcttctggatcctgcgaacgagaaattaatcaagaactacataatcaagtgtctagaagtatcatcgatatccaatttttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein SA - WD repeat domain 54 - WD repeat domain 76 - apolipoprotein C-II |