Cart 2 Product Products 234,90 € (empty)
-
1 x ZNF70-zinc...121,50 € -
1 x C14orf79-c...113,40 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
Data sheet of VBP1-von Hippel-Lindau binding protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VBP1-von Hippel-Lindau binding protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC046094 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VBP1 |
| Origin species: | Human |
| Product name: | VBP1-von Hippel-Lindau binding protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC046094 |
| Gene id: | 7411 |
| Gene description: | von Hippel-Lindau binding protein 1 |
| Synonyms: | HIBBJ46; PFD3; PFDN3; VBP-1; prefoldin subunit 3; von Hippel-Lindau binding protein 1; VHL binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggccgttaaggacagttgtggcaaaggagaaatggccacagggaatgggcggcggctccacctggggattcctgaggccgtgtttgtggaagatgtagattccttcatgaaacagcctgggaatgagactgcagatacagtattaaagaagctggatgaacagtaccagaagtataagtttatggaactcaaccttgctcaaaagaaaagaaggctaaaaggtcagattcctgaaattaaacagactttggaaattctaaaatacatgcagaagaaaaaagagtccaccaactcaatggagaccagattcttgctggcagataacctgtattgcaaagcttcagttcctcctaccgataaagtgtgtctgtggttgggggctaatgtaatgcttgaatatgatattgatgaagctcaggcattgttggaaaagaatttatcgactgccacaaagaatcttgattccctggaggaagaccttgactttcttcgagatcaatttactaccacagaagtcaatatggccagggtttataattgggatgtaaaaagaagaaacaaggatgactctaccaagaacaaagcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein LOC202051 - methyl-CpG binding domain protein 3 - THO complex 6 homolog (Drosophila) - RELT tumor necrosis factor receptor |