IL7-interleukin 7 Gene View larger

IL7-interleukin 7 Gene

PTXBC047698

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL7-interleukin 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IL7-interleukin 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC047698
Product type: DNA & cDNA
Ncbi symbol: IL7
Origin species: Human
Product name: IL7-interleukin 7 Gene
Size: 2ug
Accessions: BC047698
Gene id: 3574
Gene description: interleukin 7
Synonyms: interleukin-7; interleukin 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccatgtttcttttaggtatatctttggacttcctcccctgatccttgttctgttgccagtagcatcatctgattgtgatattgaaggtaaagatggcaaacaatatgagagtgttctaatggtcagcatcgatcaattattggacagcatgaaagaaattggtagcaattgcctgaataatgaatttaacttttttaaaagacatatctgtgatgctaataaggaaggtatgtttttattccgtgctgctcgcaagttgaggcaatttcttaaaatgaatagcactggtgattttgatctccacttattaaaagtttcagaaggcacaacaatactgttgaactgcactggccaggttaaaggaagaaaaccagctgccctgggtgaagcccaaccaacaaagagtttggaagaaaataaatctttaaaggaacagaaaaaactgaatgacttgtgtttcctaaagagactattacaagagataaaaacttgttggaataaaattttgatgggcactaaagaacactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - syntaxin 12
- vasohibin 2
- vasohibin 1
- gastrokine 1

Reviews

Buy IL7-interleukin 7 Gene now

Add to cart