Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUDT10-nudix (nucleoside diphosphate linked moiety X)-type motif 10 Gene
PTXBC049383
New product
Data sheet of NUDT10-nudix (nucleoside diphosphate linked moiety X)-type motif 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDT10-nudix (nucleoside diphosphate linked moiety X)-type motif 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC049383 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDT10 |
| Origin species: | Human |
| Product name: | NUDT10-nudix (nucleoside diphosphate linked moiety X)-type motif 10 Gene |
| Size: | 2ug |
| Accessions: | BC049383 |
| Gene id: | 170685 |
| Gene description: | nudix (nucleoside diphosphate linked moiety X)-type motif 10 |
| Synonyms: | APS2; DIPP3-alpha; DIPP3a; diphosphoinositol polyphosphate phosphohydrolase 3-alpha; diadenosine 5',5'''-P1,P6-hexaphosphate hydrolase 3-alpha; diadenosine hexaphosphate hydrolase (AMP-forming); nucleoside diphosphate-linked moiety X motif 10; nudix (nucleoside diphosphate linked moiety X)-type motif 10; nudix motif 10; nudix hydrolase 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagtgcaaacccaaccagacacggacctacgaccccgaggggttcaagaagcgggcggcgtgcctgtgcttccggagcgagcgcgaggacgaggtcctgttagtgagtagcagccggtacccggaccgctggatcgtgccgggcgggggcatggagcccgaggaggagccgggcggtgcggcggtccgagaggtgtatgaagaggcgggagtcaaggggaagttaggccggctcctgggcgtcttcgaacagaaccaggaccccaagcacagaacgtacgtgtatgtactgactgtcacggagctgttggaggattgggaagattcggttagcattgggaggaagcgagagtggttcaaagtcgaagatgccatcaaggttctccagtgccacaagcccatgcacgccgaatatctggagaaactaaagctgggcggttccccaaccaatggaaactccatggccccatcctcgccagatagcgatccctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nudix (nucleoside diphosphate linked moiety X)-type motif 10 - nudix (nucleoside diphosphate linked moiety X)-type motif 13 - Tax1 (human T-cell leukemia virus type I) binding protein 1 - ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1 |