Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CD3E-CD3e molecule, epsilon (CD3-TCR complex) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD3E-CD3e molecule, epsilon (CD3-TCR complex) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC049847 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD3E |
| Origin species: | Human |
| Product name: | CD3E-CD3e molecule, epsilon (CD3-TCR complex) Gene |
| Size: | 2ug |
| Accessions: | BC049847 |
| Gene id: | 916 |
| Gene description: | CD3e molecule, epsilon (CD3-TCR complex) |
| Synonyms: | CD3e molecule; CD3e molecule, epsilon (CD3-TCR complex); CD3e antigen, epsilon polypeptide (TiT3 complex); IMD18; T3E; TCRE; T-cell surface glycoprotein CD3 epsilon chain; CD3-epsilon; T-cell antigen receptor complex, epsilon subunit of T3; T-cell surface antigen T3/Leu-4 epsilon chain |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagtcgggcactcactggagagttctgggcctctgcctcttatcagttggtgtttgggggcaagatggtaatgaagaaatgggtggtattacacagacaccatataaagtctccatctctggaaccacagtaatattgacatgccctcagtatcctggatctgaaatactatggcaacacaatgataaaaacataggcggtgatgaggatgataaaaacataggcagtgatgaggatcacctgtcactgaaggaattttcagaattggagcaaagtggttattatgtctgctaccccagaggaagcaaaccagaagatgcgaacttttatctctacctgagggcaagagtgtgtgagaactgcatggagatggatgtgatgtcggtggccacaattgtcatagtggacatctgcatcactgggggcttgctgctgctggtttactactggagcaagaatagaaaggccaaggccaagcctgtgacacgaggagcgggtgctggcggcaggcaaaggggacaaaacaaggagaggccaccacctgttcccaacccagactatgagcccatccggaaaggccagcgggacctgtattctggcctgaatcagagacgcatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NOP16 nucleolar protein homolog (yeast) - LSM14B, SCD6 homolog B (S. cerevisiae) - cytochrome b-561 domain containing 2 - Rho guanine exchange factor (GEF) 16 |