Cart 1 Product Products 115,24 € (empty)
No products
To be determined Shipping
115,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 115,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 115,24 €
Data sheet of IL18BP-interleukin 18 binding protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL18BP-interleukin 18 binding protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC044215 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL18BP |
| Origin species: | Human |
| Product name: | IL18BP-interleukin 18 binding protein Gene |
| Size: | 2ug |
| Accessions: | BC044215 |
| Gene id: | 10068 |
| Gene description: | interleukin 18 binding protein |
| Synonyms: | IL18BPa; interleukin-18-binding protein; IL-18BP; MC51L-53L-54L homolog gene product; tadekinig-alfa; interleukin 18 binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccatgagacacaactggacaccagacctcagccctttgtgggtcctgctcctgtgtgcccacgtcgtcactctcctggtcagagccacacctgtctcgcagaccaccacagctgccactgcctcagttagaagcacaaaggacccctgcccctcccagcccccagtgttcccagcagctaagcagtgtccagcattggaagtgacctggccagaggtggaagtgccactgaatggaacgctgagcttatcctgtgtggcctgcagccgcttccccaacttcagcatcctctactggctgggcaatggttccttcattgagcacctcccaggccgactgtgggaggggagcaccagccgggaacgtgggagcacaggtacgcagctgtgcaaggccttggtgctggagcagctgacccctgccctgcacagcaccaacttctcctgtgtgctcgtggaccctgaacaggttgtccagcgtcacgtcgtcctggcccagctctgggctgggctgagggcaaccttgccccccacccaagaagccctgccctccagccacagcagtccacagcagcagggttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - muscleblind-like 3 (Drosophila) - abhydrolase domain containing 7 - SAM and SH3 domain containing 3 - RAS-like, family 10, member A |