Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HINT2-histidine triad nucleotide binding protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HINT2-histidine triad nucleotide binding protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047737 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HINT2 |
| Origin species: | Human |
| Product name: | HINT2-histidine triad nucleotide binding protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC047737 |
| Gene id: | 84681 |
| Gene description: | histidine triad nucleotide binding protein 2 |
| Synonyms: | HIT-17; histidine triad nucleotide-binding protein 2, mitochondrial; HINT-2; HINT-3; HIT-17kDa; PKCI-1-related HIT protein; protein kinase C inhibitor-2; histidine triad nucleotide binding protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcagccgtggtgctggctgctgggttgcgcgcggcgcgcagagccgtggcggccacgggggtgcgcggggggcaggtccgaggagctgcaggtgtgactgatgggaatgaagtggccaaggcccagcaggcaactcctgggggagcagccccaaccatcttctcccggatcctggacaagagcctcccagctgacattctctatgaggaccagcagtgtcttgtgttccgtgatgtggcccctcaggctcctgtgcacttcctggtcattcctaagaagcccattcctcggattagccaggctgaagaagaagaccagcagcttctaggacacctactccttgtggccaagcagacagcaaaggctgagggcctgggagatggataccgacttgtgatcaacgatgggaagctgggtgcacaatctgtgtatcatctgcacattcatgtacttgggggccggcagctccagtggcctccaggttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ankyrin repeat domain 13 family, member D - Rho GDP dissociation inhibitor (GDI) gamma - katanin p60 (ATPase-containing) subunit A 1 - actin filament associated protein 1-like 1 |