PTXBC046645
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC046645 |
Product type: | DNA & cDNA |
Ncbi symbol: | CCBE1 |
Origin species: | Human |
Product name: | CCBE1-collagen and calcium binding EGF domains 1 Gene |
Size: | 2ug |
Accessions: | BC046645 |
Gene id: | 147372 |
Gene description: | collagen and calcium binding EGF domains 1 |
Synonyms: | HKLLS1; collagen and calcium-binding EGF domain-containing protein 1; full of fluid protein homolog; collagen and calcium binding EGF domains 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggtgaaagccggaacttgctgtgccacatgcaaggagttctaccagatgaagcagaccgtgctgcagctgaagcaaaagattgctctgctccccaacaatgcagctgacctgggcaagtatatcactggtgacaaggtgctggcctcaaacacctaccttccaggacctcctggcctgcctgggggccagggccctcccggctcaccaggaccaaagggaagcccaggcttccccggtatgccaggccctcctgggcagcccggcccacggggctcaatgggacccatgggaccatctcctgatctgtcccacattaagcaaggccggaggggccctgtgggtccaccaggggcaccaggaagagatggttctaagggggagagaggagcgcctgggcccagagggtctccaggaccccctggttctttcgacttcctgctacttatgctggctgacatccgcaatgacatcactgagctgcaggaaaaggtgttcgggcaccggactcactcttcagcagaggagttccctttacctcaggaatttcccagctacccagaagccatggacctgggctctggagatgaccatccaagaagaactgagacaagagacttgagagcccccagagacttctacccatag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - transcription elongation factor A (SII), 2 - 2'-5'-oligoadenylate synthetase 2, 69/71kDa - WNT1 inducible signaling pathway protein 2 - C-type lectin domain family 12, member A |