Cart 19 Product Products 3 017,06 € (empty)
-
1 x DUSP3-dual...113,40 € -
1 x EFCAB1-EF-...113,40 € -
-
1 x OR2K2-olfa...121,50 € -
1 x MYL6B-myos...113,40 € -
1 x XAGE3-X...113,40 € -
-
-
-
1 x PRR16-prol...113,40 € -
-
1 x RPL3-ribos...121,50 € -
-
-
-
1 x Cyclophilin A744,00 € -
-
1 x ZNF3-zinc...121,50 € -
No products
To be determined Shipping
3 017,06 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 19 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 017,06 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 017,06 €
Data sheet of MRPL41-mitochondrial ribosomal protein L41 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL41-mitochondrial ribosomal protein L41 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC040035 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL41 |
| Origin species: | Human |
| Product name: | MRPL41-mitochondrial ribosomal protein L41 Gene |
| Size: | 2ug |
| Accessions: | BC040035 |
| Gene id: | 64975 |
| Gene description: | mitochondrial ribosomal protein L41 |
| Synonyms: | BMRP; MRP-L27; MRPL27; PIG3; RPML27; 39S ribosomal protein L41, mitochondrial; 39S ribosomal protein L27 homolog; L41mt; MRP-L27 homolog; MRP-L41; bcl-2-interacting mitochondrial ribosomal protein L41; cell proliferation-inducing gene 3 protein; proliferation-inducing gene 3; mitochondrial ribosomal protein L41 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcgtcctggccgcagcggcgcgctgcctggtccggggtgcggaccgaatgagcaagtggacgagcaagcggggcccgcgcagcttcaggggccgcaagggccggggcgccaagggcatcggcttcctcacctcgggctggaggttcgtgcagatcaaggagatggtcccggagttcgtcgtcccggatctgaccggcttcaagctcaagccctacgtgagctacctcgcccctgagagcgaggagacgcccctgacggccgcgcagctcttcagcgaagccgtggcgcctgccatcgaaaaggacttcaaggacggtaccttcgaccctgacaacctggaaaagtacggcttcgagcccacacaggagggaaagctcttccagctctaccccaggaacttcctgcgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 6 open reading frame 66 - KTEL (Lys-Tyr-Glu-Leu) containing 1 - chromosome 4 open reading frame 35 - chromosome 2 open reading frame 62 |