Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFS6-NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase) Gene
PTXBC046155
New product
Data sheet of NDUFS6-NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFS6-NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC046155 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFS6 |
| Origin species: | Human |
| Product name: | NDUFS6-NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase) Gene |
| Size: | 2ug |
| Accessions: | BC046155 |
| Gene id: | 4726 |
| Gene description: | NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase) |
| Synonyms: | NADH:ubiquinone oxidoreductase NDUFS6 subunit; CI-13kA; CI-13kD-A; CI13KDA; NADH dehydrogenase [ubiquinone] iron-sulfur protein 6, mitochondrial; NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase); NADH-ubiquinone oxidoreductase 13 kDa-A subunit; complex I 13kDa subunit A; complex I, mitochondrial respiratory chain, 13-kD subunit; NADH:ubiquinone oxidoreductase subunit S6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggcgatgaccttctgccggctgctgaaccggtgtggcgaggcggcgcggagcctgcccctgggcgccaggtgtttcggggtgcgggtctcgccgaccggggagaaggtcacgcacactggccaggtttatgatgataaagactacaggagaattcggtttgtaggtcgtcagaaagaggtgaatgaaaactttgccattgatttgatagcagagcagcccgtgagcgaggtggagactcgggtgatagcgtgcgatggcggcgggggagctcttggccacccaaaagtgtatataaacttggacaaagaaacaaaaaccggcacatgcggttactgtgggctccagttcagacagcaccaccactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) - potassium large conductance calcium-activated channel, subfamily M, beta member 2 - glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 - killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2 |