Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SPINLW1-serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin) Gene
PTXBC053369
New product
Data sheet of SPINLW1-serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPINLW1-serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC053369 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPINLW1 |
| Origin species: | Human |
| Product name: | SPINLW1-serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin) Gene |
| Size: | 2ug |
| Accessions: | BC053369 |
| Gene id: | 57119 |
| Gene description: | serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin) |
| Synonyms: | SPINLW1; CT71; CT72; WAP7; WFDC7; dJ461P17.2; WAP four-disulfide core domain protein 7; cancer/testis antigen 71; cancer/testis antigen 72; epididymal protease inhibitor; protease inhibitor WAP7; serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin); epididymal peptidase inhibitor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggatcttctggacttttgagcctcctggtgctattcgtcctcttagcgaatgtccagggacctggtctgactgattggttatttcccaggagatgtcccaaaatcagagaagaatgtgaattccaagaaagggatgtgtgtacaaaggacagacaatgccaggacaacaagaagtgttgtgtcttcagctgcggaaaaaaatgtttagatctcaaacaagatgtatgcgaaatgccaaaagaaactggcccctgcctggcttattttcttcattggtggtatgacaagaaagataatacttgctccatgtttgtctatggtggctgccagggaaacaataacaacttccaatccaaagccaactgcctgaacacctgcaagaataaacgctttccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 22 (organic anion/urate transporter), member 12 - CD74 molecule, major histocompatibility complex, class II invariant chain - solute carrier family 16, member 10 (aromatic amino acid transporter) - growth arrest and DNA-damage-inducible, gamma interacting protein 1 |