Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCL14-chemokine (C-C motif) ligand 14 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCL14-chemokine (C-C motif) ligand 14 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC038289 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL14 |
| Origin species: | Human |
| Product name: | CCL14-chemokine (C-C motif) ligand 14 Gene |
| Size: | 2ug |
| Accessions: | BC038289 |
| Gene id: | 6358 |
| Gene description: | chemokine (C-C motif) ligand 14 |
| Synonyms: | CC-1; CC-3; CKB1; HCC-1; HCC-1(1-74); HCC-1/HCC-3; HCC-3; MCIF; NCC-2; NCC2; SCYA14; SCYL2; SY14; C-C motif chemokine 14; chemokine (C-C motif) ligand 14; chemokine CC-1/CC-3; chemokine CC-3; hemofiltrate CC chemokine 1; new CC chemokine 2; small inducible cytokine subfamily A (Cys-Cys), member 14; small-inducible cytokine A14; C-C motif chemokine ligand 14 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagatctccgtggctgccattcccttcttcctcctcatcaccatcgccctagggaccaagactgaatcctcctcacggggaccttaccacccctcagagtgctgcttcacctacactacctacaagatcccgcgtcagcggattatggattactatgagaccaacagccagtgctccaagcccggaattgtcttcatcaccaaaaggggccattccgtctgtaccaaccccagtgacaagtgggtccaggactatatcaaggacatgaaggagaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interleukin 18 binding protein - muscleblind-like 3 (Drosophila) - abhydrolase domain containing 7 - SAM and SH3 domain containing 3 |