Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of UBL4A-ubiquitin-like 4A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBL4A-ubiquitin-like 4A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC043346 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBL4A |
| Origin species: | Human |
| Product name: | UBL4A-ubiquitin-like 4A Gene |
| Size: | 2ug |
| Accessions: | BC043346 |
| Gene id: | 8266 |
| Gene description: | ubiquitin-like 4A |
| Synonyms: | DX254E; DXS254E; G6PD; GDX; GET5; MDY2; TMA24; UBL4; ubiquitin-like protein 4A; ubiquitin-like 4; ubiquitin-like protein GDX; ubiquitin like 4A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagctgacggtgaaggcgctgcagggccgcgagtgcagcctgcaggtgccagaggacgagctggtgtccacgctgaagcagctggtctccgagaagctgaacgtcccagtgcgccagcagcggctgctgttcaagggcaaggccctggcagatgggaaacgactctcggattatagcatcgggcccaactccaagctcaacctagtggtcaaacccctggagaaggtgctactagaagaaggcgaggcccagaggctggccgactccccacccccgcaggtctggcagctgatctccaaagtcttggcccgccacttcagtgcggcagatgccagcagggtcctggaacagctacagagggattacgagaggtccctgagtcgcctgacgctggacgacatcgaacggttggccagccgcttcctgcaccctgaagtgactgagacaatggagaagggcttctccaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nucleoporin 35kDa - nucleoporin 62kDa - attractin-like 1 - F-box protein 38 |