Cart 7 Product Products 963,77 € (empty)
-
1 x ZNF616-zin...113,40 € -
1 x MAB21L1-ma...121,50 € -
1 x RNASE3-rib...113,40 € -
1 x HLA-DQA1-m...113,40 € -
1 x EIF2B2-euk...121,50 € -
1 x SREC-II...259,07 € -
1 x CXXC5-CXXC...121,50 €
No products
To be determined Shipping
963,77 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 963,77 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 963,77 €
Data sheet of KIAA0284-KIAA0284 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIAA0284-KIAA0284 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047913 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIAA0284 |
| Origin species: | Human |
| Product name: | KIAA0284-KIAA0284 Gene |
| Size: | 2ug |
| Accessions: | BC047913 |
| Gene id: | 283638 |
| Gene description: | KIAA0284 |
| Synonyms: | KIAA0284; CEP170R; FAM68C; centrosomal protein of 170 kDa protein B; Cep170-related; centrosomal protein 170B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgaacccggtgtcccagctgtcgcaggccatccgtgagaacacagagcaccttgccgagaagatgaagatcctctttcagaacacagggagagcttgggaggacctggaagccaggatcaacgccgagaacgaggtgcccatcctgaagacatctaacaaggaaatcagctccatcctgaaggaactgaggcgggtgcagaaacagctggaagttatcaatgccatcgtggaccccagtgggagcctggacctgctcacaggaaacaggagcttggccagctctgcacagccggggctggggaagggccgcgtggctgcccagagcccaccctcacccgcctcagccgaggccctgctgccagccctgcccctgaggaatttcccacagcgggccagctgtgggcctcccagcctcccggaccccaccttcctccctgatgccgagaggttcctgatctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ovostatin 2 - homeobox C4 - interleukin 7 - syntaxin 12 |