GLT1D1-glycosyltransferase 1 domain containing 1 Gene View larger

GLT1D1-glycosyltransferase 1 domain containing 1 Gene

PTXBC043528

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GLT1D1-glycosyltransferase 1 domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GLT1D1-glycosyltransferase 1 domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC043528
Product type: DNA & cDNA
Ncbi symbol: GLT1D1
Origin species: Human
Product name: GLT1D1-glycosyltransferase 1 domain containing 1 Gene
Size: 2ug
Accessions: BC043528
Gene id: 144423
Gene description: glycosyltransferase 1 domain containing 1
Synonyms: glycosyltransferase 1 domain-containing protein 1; glycosyltransferase 1 domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggctcctgttcctggcggtgctgcggccacacaccggcaacgcggtcacggcccagcgcgttcgggcccatctagaggctgcagggcacgtgtgcgttttgaaggatgcctttgactttgaaagccgatctgagattgcaaacctcatcttggctgagaactgcgaggctgccctggctcttcatctctataggggaggcaggcttttgcaaggccaccgaatcccttttggagtcatctttggtggaactgatgtaaatgaagatgccaaccaggcggaaaaaaacacagtcatgggcagagttcttgaggaagccagccgcatgctaagggtaaggtctatgtccagagtcaaggaattgcaacaacaccaaacgccgcttttaactggaatacctttcttcaacgctctgagattaaccaaagtgctgataatttgcacatatttcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - trafficking protein particle complex 6B
- ribosomal protein S19 binding protein 1
- collagen and calcium binding EGF domains 1
- transcription elongation factor A (SII), 2

Reviews

Buy GLT1D1-glycosyltransferase 1 domain containing 1 Gene now

Add to cart