> >>PAPLN-papilin, proteoglycan-like sulfated glycoprotein Gene
PAPLN-papilin, proteoglycan-like sulfated glycoprotein Gene View larger

PAPLN-papilin, proteoglycan-like sulfated glycoprotein Gene

PTXBC042057

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of PAPLN-papilin, proteoglycan-like sulfated glycoprotein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PAPLN-papilin, proteoglycan-like sulfated glycoprotein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC042057
Product type: DNA & cDNA
Ncbi symbol: PAPLN
Origin species: Human
Product name: PAPLN-papilin, proteoglycan-like sulfated glycoprotein Gene
Size: 2ug
Accessions: BC042057
Gene id: 89932
Gene description: papilin, proteoglycan-like sulfated glycoprotein
Synonyms: papilin; papilin, proteoglycan like sulfated glycoprotein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggctgctcctgctcgtgccgctgctgctggctccagcgcccgggtcctcggctcccaaggtgaggcggcagagtgacacctggggaccctggagccagtggagcccctgcagccggacctgtggagggggtgtcagcttccgggagcgcccctgctactcccagaggagagatggaggctccagctgcgtgggccccgcccggagccaccgctcttgtcgcacggagagctgccccgacggcgcccgggacttccgggccgagcagtgcgcggagttcgacggagcggagttccaggggcggcggtatcggtggctgccctactacagcgccccaaacaagtgtgaactgaactgcattcccaaagtgctgggattacaggcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Rho guanine nucleotide exchange factor (GEF) 7
- nuclear factor related to kappaB binding protein
- leucine-rich repeats and transmembrane domains 1
- succinate-CoA ligase, GDP-forming, beta subunit

Reviews

Buy PAPLN-papilin, proteoglycan-like sulfated glycoprotein Gene now

Add to cart