ZNRD1-zinc ribbon domain containing 1 Gene View larger

ZNRD1-zinc ribbon domain containing 1 Gene

PTXBC050608

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNRD1-zinc ribbon domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNRD1-zinc ribbon domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050608
Product type: DNA & cDNA
Ncbi symbol: ZNRD1
Origin species: Human
Product name: ZNRD1-zinc ribbon domain containing 1 Gene
Size: 2ug
Accessions: BC050608
Gene id: 30834
Gene description: zinc ribbon domain containing 1
Synonyms: HTEX-6; HTEX6; Rpa12; TCTEX6; TEX6; ZR14; hZR14; tctex-6; DNA-directed RNA polymerase I subunit RPA12; RNA polymerase I small specific subunit Rpa12; transcription-associated zinc ribbon protein; zinc ribbon domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgtcatggacctcgccaatacttgctccagctttcagtcggacctggatttctgttcagattgcggctcggtcctgcctctgcccggggctcaggatacggtcacctgtattcgctgtggcttcaacatcaacgttcgggactttgaggggaaggttgtgaagacttcggttgtgttccaccaactggggacagccatgcctatgtcggtggaggaagggcctgagtgccagggacctgtggttgacaggcgctgccctcgatgtggtcatgaaggaatggcataccacaccagacaaatgcgttcagccgatgaagggcaaactgtcttctacacctgtaccaactgcaagttccaggagaaggaagactcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TBC1 domain family, member 14
- ubiquitin specific peptidase 20
- chemokine (C-C motif) ligand 14
- interleukin 18 binding protein

Reviews

Buy ZNRD1-zinc ribbon domain containing 1 Gene now

Add to cart