Cart 30 Product Products 3 975,67 € (empty)
-
1 x RAB6A-RAB6...113,40 € -
1 x HDHD2-halo...113,40 € -
1 x IDI1-isope...113,40 € -
-
1 x AASDHPPT-a...121,50 € -
1 x OCM-oncomo...113,40 € -
1 x IFNA21-int...113,40 € -
1 x IFNB1-inte...113,40 € -
1 x ABHD14A...259,07 € -
-
1 x DDIT4L-DNA...113,40 € -
1 x APLN-apeli...113,40 € -
1 x UBE2V1-ubi...113,40 € -
-
1 x ST3GAL3-ST...121,50 € -
-
1 x RAC2-ras-r...113,40 € -
-
1 x LDOC1-leuc...113,40 € -
1 x APOBEC3B-a...113,40 € -
1 x HEPACAM-he...121,50 € -
-
1 x DIRAS3-DIR...113,40 € -
1 x APCS-amylo...113,40 € -
1 x OFCC1-orof...113,40 € -
-
1 x PARS2-prol...121,50 € -
1 x WDR21A-WD...121,50 € -
-
1 x CLEC3B-C-t...113,40 €
No products
To be determined Shipping
3 975,67 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 30 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 975,67 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 975,67 €
Data sheet of RPAIN-RPA interacting protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPAIN-RPA interacting protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC046349 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPAIN |
| Origin species: | Human |
| Product name: | RPAIN-RPA interacting protein Gene |
| Size: | 2ug |
| Accessions: | BC046349 |
| Gene id: | 84268 |
| Gene description: | RPA interacting protein |
| Synonyms: | HRIP; RIP; RPA-interacting protein; RAP interaction protein; nuclear transporter; RPA interacting protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggagtcgttgaggtctccgcgccgctccctgtacaaactggtgggctcgccgccttggaaagaggctttccggcagagatgcctggagagaatgagaaacagccgggacaggctcctaaacaggtaccgccaggctggaagcagtgggccagggaattctcagaacagctttctagttcaagaggtgatggaagaagagtggaatgctttgcagtcagtggagaattgtccagaagacttggctcagctggaggagctgatagacatggctgtgctggaggaaattcaacaggagctgatcaaccaaggcctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RPA interacting protein - neuromedin U receptor 1 - EMI domain containing 1 - paternally expressed 10 |