Cart 9 Product Products 1 053,97 € (empty)
-
1 x SNX32-sort...121,50 € -
-
1 x C5orf30-ch...113,40 € -
1 x ASS1-argin...121,50 € -
1 x RBMY1A1-RN...121,50 € -
1 x PRRT2-prol...121,50 € -
1 x CBLN4-cere...113,40 € -
1 x TBPL1-TBP-...113,40 € -
1 x GTPBP10-GT...121,50 €
No products
To be determined Shipping
1 053,97 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 053,97 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 053,97 €
View larger 
ERG-v-ets erythroblastosis virus E26 oncogene homolog (avian) Gene
PTXBC040168
New product
Data sheet of ERG-v-ets erythroblastosis virus E26 oncogene homolog (avian) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ERG-v-ets erythroblastosis virus E26 oncogene homolog (avian) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC040168 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ERG |
| Origin species: | Human |
| Product name: | ERG-v-ets erythroblastosis virus E26 oncogene homolog (avian) Gene |
| Size: | 2ug |
| Accessions: | BC040168 |
| Gene id: | 2078 |
| Gene description: | v-ets erythroblastosis virus E26 oncogene homolog (avian) |
| Synonyms: | ERG, ETS transcription factor; transcriptional regulator ERG (transforming protein ERG); erythroblast transformation-specific transcription factor ERG variant 10; TMPRSS2/ERG fusion; transcriptional regulator ERG; erg-3; p55; ets-related; v-ets avian erythroblastosis virus E26 oncogene homolog; v-ets avian erythroblastosis virus E26 oncogene related; v-ets erythroblastosis virus E26 oncogene homolog; v-ets erythroblastosis virus E26 oncogene like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagcactattaaggaagccttatcagttgtgagtgaggaccagtcgttgtttgagtgtgcctacggaacgccacacctggctaagacagagatgaccgcgtcctcctccagcgactatggacagacttccaagatgagcccacgcgtccctcagcaggattggctgtctcaacccccagccagggtcaccatcaaaatggaatgtaaccctagccaggtgaatggctcaaggaactctcctgatgaatgcagtgtggccaaaggcgggaagatggtgggcagcccagacaccgttgggatgaactacggcagctacatggaggagaagcacatgccacccccaaacatgaccacgaacgagcgcagagttatcgtgccagcagatcctacgctatggagtacagaccatgtgcggcagtggctggagtgggcggtgaaagaatatggccttccagacgtcaacatcttgttattccagaacatcgatgggaaggaactgtgcaagatgaccaaggacgacttccagaggctcacccccagctacaatgccgacatccttctctcacatctccactacctcagagagactcctcttccacatttgacttcagatgatgttgataaagccttacaaaactctccacggttaatgcatgctagaaacacagggggtgcagcttttattttcccaaatacttcagtatatcctgaagctacgcaaagaattacaactaggccagatttaccatatgagccccccaggagatcagcctggaccggtcacggccaccccacgccccagtcgaaagctgctcaaccatctccttccacagtgcccaaaactgaagaccagcgtcctcagttagatccttatcagattcttggaccaacaagtagccgccttgcaaatccaggcagtggccagatccagctttggcagttcctcctggagctcctgtcggacagctccaactccagctgcatcacctgggaaggcaccaacggggagttcaagatgacggatcccgacgaggtggcccggcgctggggagagcggaagagcaaacccaacatgaactacgataagctcagccgcgccctccgttactactatgacaagaacatcatgaccaaggtccatgggaagcgctacgcctacaagttcgacttccacgggatcgcccaggccctccagccccaccccccggagtcatctctgtacaagtacccctcagacctcccgtacatgggctcctatcacgcccacccacagaagatgaactttgtggcgccccaccctccagccctccccgtgacatcttccagtttttttgctgccccaaacccatactggaattcaccaactgggggtatataccccaacactaggctccccaccagccatatgccttctcatctgggcacttactactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - synaptosomal-associated protein, 91kDa homolog (mouse) - UDP glucuronosyltransferase 1 family, polypeptide A10 - solute carrier family 39 (zinc transporter), member 6 - transmembrane and tetratricopeptide repeat containing 1 |