Cart 26 Product Products 4 665,13 € (empty)
-
-
1 x ZBTB43-zin...121,50 € -
1 x BCAT2-bran...121,50 € -
1 x FLJ32063-h...113,40 € -
1 x LSM2-LSM2...113,40 € -
1 x THEX1-thre...121,50 € -
-
1 x C14orf94-c...121,50 € -
1 x SIAH1-seve...121,50 € -
1 x PHC2-polyh...121,50 € -
1 x NUF2-NUF2,...121,50 € -
1 x GLYATL2-gl...121,50 € -
1 x SLC25A31-s...121,50 € -
1 x LigaTrap...576,82 € -
1 x AQP1-aquap...121,50 € -
1 x TSPAN6-tet...113,40 € -
1 x UTP11L-UTP...113,40 € -
1 x CORO6-coro...113,40 € -
1 x AQP3-aquap...121,50 € -
1 x RAD9A-RAD9...121,50 € -
1 x BRSK1-BR...121,50 € -
1 x TFB1M-tran...121,50 € -
1 x CDIPT-CDP-...113,40 € -
1 x DDO-D-aspa...121,50 € -
1 x LOC553158-...121,50 € -
1 x LigaTrap...945,91 €
No products
To be determined Shipping
4 665,13 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 26 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 665,13 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 665,13 €
Data sheet of ARHGAP25-Rho GTPase activating protein 25 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARHGAP25-Rho GTPase activating protein 25 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC039591 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARHGAP25 |
| Origin species: | Human |
| Product name: | ARHGAP25-Rho GTPase activating protein 25 Gene |
| Size: | 2ug |
| Accessions: | BC039591 |
| Gene id: | 9938 |
| Gene description: | Rho GTPase activating protein 25 |
| Synonyms: | HEL-S-308; KAIA0053; rho GTPase-activating protein 25; epididymis secretory protein Li 308; rho-type GTPase-activating protein 25; Rho GTPase activating protein 25 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccctcggtcagtcggcctgtctgttcctctctatagctcggtcaaggagtgtgatgactggcgagcagatggctgccttccatccatcgtccacccccaacccgctggagaggcccatcaagatgggctggctgaagaagcagaggtccatcgtgaagaactggcagcagaggtactttgtgctgagggcgcagcagctctactactacaaggatgaagaggacacgaagccccagggctgcatgtatctaccaggatgtacaatcaaggagatcgccacaaacccagaagaagctgggaagtttgtctttgaaatcattccagcctcatgggaccagaatcgcatgggacaggactcctatgtcctcatggccagctctcaggcggagatggaggagtgggttaaattcctcaggagagttgctggcacaccctgtggagcagtgtttggccagcgcttggatgagactgtggcctatgaacagaaattcggcccccatctggtgcccatcctggtggagaaatgtgcagagttcatcctggagcacggccggaatgaagagggcatcttccgtctgcctgggcaggacaacctggtgaagcagctgagagacgcttttgatgctggggagcggccctcctttgacagagacacagatgtgcacactgtggcttccctgttaaagctctacctccgagacctcccagagcccgtggttccctggagccagtacgaagggttcctgctctgtgggcagctcacgaatgcggatgaggcaaaggctcagcaggagttgatgaagcagctctccatccttcctcgtgacaactatagtctcctgagctacatctgcaggttcctacatgaaatacagctgaactgtgctgttaacaagatgagtgtggacaacctggctactgtgattggtgtgaatctcatcaggtcgaaggtcgaagaccctgccgtgatcatgagagggactcctcagatccaaagagtgatgactatgatgatcagagaccatgaagtcctcttccccaagtccaaggatatacccctgtcaccccctgcccagaaaaatgaccccaagaaagctccagtggcccgaagctctgtaggctgggatgccactgaagacctccgaatttctaggacagacagcttcagtagcatggtaaggtgcagagaaccttcctgcttccattgggttcttcctttagtccaggccatcccatgtaaggcctgctctcgggtggcaatttggggagttttaggtgatgcagtggcagtgggcgctgctgctacagactcatctgaacacaccttgaaagcctggcctctttccaaatctagtttctattggcatctttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil domain containing 88C - baculoviral IAP repeat-containing 3 - SRY (sex determining region Y)-box 5 - microfibrillar-associated protein 1 |