Cart 17 Product Products 3 400,92 € (empty)
-
1 x ABCA9-ATP-...113,40 € -
1 x ABHD13-abh...113,40 € -
-
1 x AMIGO1-adh...121,50 € -
1 x FBLN7-fibu...121,50 € -
-
1 x CLEC7A-C-t...113,40 € -
1 x ABCA11P-AT...113,40 € -
1 x C1orf62-ch...121,50 € -
1 x ABCA3-ATP-...113,40 € -
-
-
-
1 x ABT1-activ...121,50 € -
1 x Histone H3...259,07 € -
-
No products
To be determined Shipping
3 400,92 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 17 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 400,92 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 400,92 €
View larger 
IFT52-intraflagellar transport 52 homolog (Chlamydomonas) Gene
PTXBC039831
New product
Data sheet of IFT52-intraflagellar transport 52 homolog (Chlamydomonas) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IFT52-intraflagellar transport 52 homolog (Chlamydomonas) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC039831 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IFT52 |
| Origin species: | Human |
| Product name: | IFT52-intraflagellar transport 52 homolog (Chlamydomonas) Gene |
| Size: | 2ug |
| Accessions: | BC039831 |
| Gene id: | 51098 |
| Gene description: | intraflagellar transport 52 homolog (Chlamydomonas) |
| Synonyms: | C20orf9; CGI-53; NGD2; NGD5; intraflagellar transport protein 52 homolog; protein NGD5 homolog; intraflagellar transport 52 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagaaagagctgcggagcaccattcttttcaatgcctacaaaaaggagatatttaccaccaacaatggctacaaatccatgcagaaaaaacttcggagtaattggaagattcagagcttaaaagatgaaatcacatctgagaagttaaatggagtaaaactgtggattacagctgggccaagggaaaaatttactgcagctgagtttgaaatcctgaagaaatatcttgacactggtggagatgtctttgtgatgctaggagaaggtggagaatccagatttgacaccaatattaactttttactagaagaatatggaatcatggttaataatgatgctgtggttagaaatgtatatcacaaatatttccatcctaaagaagctctagtttccagtggagtcttgaacagggaaattagccgagctgcaggaaaggctgtgcctgggatcattgatgaggaaagcagtggaaacaatgcccaggctctcacctttgtgtatccttttggtgccacattgagtgtcatgaaaccagcagtggcggttctgtctacaggttctgtctgcttcccacttaacagacccattttggctttctatcactcaaagaaccaaggtgggaagctggcagtgcttggttcatgtcacatgttcagtgatcaatatttggacaaagaagaaaacagcaaaatcatggatgttgttttccagtggctcacgacaggagacatccacctaaaccagattgatgctgaggacccagagatttctgactacatgatgctgccctacacagccaccctatcaaagcggaatcgagagtgtctccaggagagtgatgagatcccaagggactttaccaccctcttcgacctgtccatcttccagctggataccacctccttccacagcgtcatcgaggctcacgagcagctaaatgtgaaacatgaaccactccagctcatccagcctcagtttgagacgccgctgccaacccttcagcctgcggtttttcctcccagtttccgggagttaccacctcctcctctggagctatttgatttagatgaaacgttctcctctgagaaggcacggctggctcagattaccaataagtgtactgaagaagacctggaattttatgtcaggaagtgtggtgatattcttggagtaaccagtaaactaccaaaggaccaacaggatgccaaacatatccttgagcacgtcttcttccaagtggtggagttcaagaaattgaaccaggaacatgacatcgatacaagtgaaacagcattccagaacaatttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aryl hydrocarbon receptor nuclear translocator-like - ribosomal protein S6 kinase, 90kDa, polypeptide 4 - endothelin converting enzyme-like 1, pseudogene 2 - NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) |