Cart 1 Product Products 121,50 € (empty)
-
1 x TLE6-trans...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
Data sheet of OPHN1-oligophrenin 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OPHN1-oligophrenin 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC059393 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OPHN1 |
| Origin species: | Human |
| Product name: | OPHN1-oligophrenin 1 Gene |
| Size: | 2ug |
| Accessions: | BC059393 |
| Gene id: | 4983 |
| Gene description: | oligophrenin 1 |
| Synonyms: | ARHGAP41; MRX60; OPN1; oligophrenin-1; mental retardation, X-linked 60; oligophrenin-1, Rho-GTPase activating protein; oligophrenin 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtcatcccccgctggagttcagcgactgctacctggacagccccgatttccgcgagaggctcaagtgttatgagcaggaactggagaggaccaacaaattcatcaaagacgtaatcaaagacggcaacgcgcttatcagcgctatgagaaattattcttctgctgttcagaaattttcccagacgctgcagtcatttcagtttgatttcattggagacactctgactgatgatgaaattaacatcgctgaatccttcaaggaatttgctgaattgctcaacgaggtagaaaatgagaggatgatgatggtacacaatgctagtgatttgctgattaaacccttggaaaatttccggaaggaacaaataggcttcaccaaggagcggaaaaagaaatttgaaaaggatggtgagaggttttattctttactggatcggcacttacacctgtcttcaaaaaagaaagaatctcagttacaagaggcagacctacaggtggacaaggagaggcacaattttttcgagtcctctcttgattatgtttatcaaatccaggaagttcaggagtccaagaagttcaatattgtggagcctgtcttggcctttcttcatagtctgttcatttctaacagcctgactgtggagctcacacaggatttcctcccatacaaacaacagctccaactcagtttacagaatacaagaaatcatttctccagtacccgggaagagatggaagaacttaagaaaaggatgaaagaagctccccagacatgcaaacttccaggacagccaactattgaaggctatctctatacacaagagaaatgtgtgtggggacataggggtatccattgggtttcaataagccaggaactactgccacttgtcggctgtgaattttgggcacccttactgttcatagacccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADPH oxidase 4 - synaptotagmin V - sideroflexin 1 - nemo-like kinase |