PTXBC066987
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC066987 |
Product type: | DNA & cDNA |
Ncbi symbol: | DPY19L2P1 |
Origin species: | Human |
Product name: | DPY19L2P1-dpy-19-like 2 pseudogene 1 (C. elegans) Gene |
Size: | 2ug |
Accessions: | BC066987 |
Gene id: | 554236 |
Gene description: | dpy-19-like 2 pseudogene 1 (C. elegans) |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaagaaacaaggagtaaacccaaagccgctgcaatcttcccgccccagcccgtctaagcggccgtacggggcctcccccgcccgggagctggaggtggaaaagtcggccctaggcggcgggaaactgccagggggcgccaggaggtcctccccggggaggatcccaaatctgaaaaagcgaaaaggcttggagctaaaggtggtggccaagacccttctcgaccccttccagttcgtccgtaattccctggcgcagctccgggaagaggtgcacgaactgcaggcgcggtggttccccagcagaaccactctcagcatcgccatctttgtggcaattctacattggttacatttagtaacactttttgaaaatgatcgtcatttctctcacctctcatctttggaatgggagatgacttttcgcactaaaatgggactttattattcctacttcaagaccatcattgaagcaccttcatttttggaaggactgtggatgattatgaatgacaggcttactgaatatcctcttgtaattaatacagtaaaacgcttccatctttatccagaggtaatcatagctgcctggtatcgcacattcataggaataatgaatttatttggactagaaactaagacctgctggaatgtcaccagaatagaacctcttaatgagttcaaagctgtgaaggattgggagatcctgcttgcttttatgttggtgtaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - zinc finger and SCAN domain containing 12 - phosphatidylethanolamine N-methyltransferase - RAB3A interacting protein (rabin3)-like 1 - suppressor of Ty 3 homolog (S. cerevisiae) |