C18orf1-chromosome 18 open reading frame 1 Gene View larger

C18orf1-chromosome 18 open reading frame 1 Gene

PTXBC066971

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C18orf1-chromosome 18 open reading frame 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C18orf1-chromosome 18 open reading frame 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC066971
Product type: DNA & cDNA
Ncbi symbol: C18orf1
Origin species: Human
Product name: C18orf1-chromosome 18 open reading frame 1 Gene
Size: 2ug
Accessions: BC066971
Gene id: 753
Gene description: chromosome 18 open reading frame 1
Synonyms: C18orf1; low-density lipoprotein receptor class A domain-containing protein 4; clone 22; low density lipoprotein receptor class A domain containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggtggtcatcgtctgcctgctgaaccactacaaagtctccacgcggtccttcatcaaccgcccgaaccagagccggaggcgggaggacgggctgccgcaggaagggtgcctgtggccttcagacagcgccgcaccgcagctgggcgcctcggagatcatgcatgccacgcggtccagggacaggttcacagcgccgtccttcatccagagggatcgcttcagccgcttccagcccacctacccctatgtgcagcacgagattgatcttcctcccaccatctccctgtcggacggtgaagagccgcctccttaccaggggccatgcaccctgcagctccgggacactgaacagcagatggaactcaaccgagagtccgtgagggccccacccaaccgaaccatatttgacagtgatttaatagacattgctatgtatagcgggggtccatgcccacccagcagcaactcgggcatcagtgcaagcacctgcagcagtaacgggaggatggaggggccaccccccacatacagcgaggtgatgggccaccacccaggcgcctctttcctccatcaccagcgcagcaacgcacacaggggcagcagactgcagtttcagcagaacaatgcagagagcacaatagtaccaatcaaaggcaaagataggaagcctgggaacctggtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 3 open reading frame 25
- chromosome 4 open reading frame 37
- solute carrier family 38, member 3
- thromboxane A synthase 1 (platelet)

Reviews

Buy C18orf1-chromosome 18 open reading frame 1 Gene now

Add to cart