Cart 3 Product Products 510,33 € (empty)
-
-
1 x C6orf168-c...121,50 € -
1 x FAM122C-fa...113,40 €
No products
To be determined Shipping
510,33 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 510,33 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 510,33 €
Data sheet of OVOL1-ovo-like 1(Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OVOL1-ovo-like 1(Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC059408 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OVOL1 |
| Origin species: | Human |
| Product name: | OVOL1-ovo-like 1(Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC059408 |
| Gene id: | 5017 |
| Gene description: | ovo-like 1(Drosophila) |
| Synonyms: | HOVO1; ovo homolog-like 1; ovo like zinc finger 1; ovo-like 1(Drosophila); ovo like transcriptional repressor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccccgcgcgttcctggtgaagaagccgtgcgtctccacgtgcaagaggaactggagcgagctccccgacgaggagcgcggcgagatctacgtgccagtcagcctgggcttctgcccaccacagccctaccgggagccggaaccctctgtggccgaacccccttcctgcccgctggctttgaacatgagccttcgagactctagctacagcatggcccccgggccctgtgtggtggcccagctgccctctgaagacatgggccacttgacagacccccagagcagagaccatggcttcctgcgcaccaagatgaaggtgacccttggggacagtcccagtggagacctgttcacctgccgtgtctgccagaaggccttcacctaccagcgcatgctgaaccgccacatgaagtgtcacaacgacgtcaagaggcacctctgcacgtactgcgggaagggcttcaatgacaccttcgacctcaagagacacgtccgaactcacactggcgtgcggccctacaagtgcagcctgtgtgacaaggccttcacgcagcgctgctctctggagtctcacctcaagaagatccatggtgtgcagcagaagtacgcgtacaaggagcggcgggccaagctgtacgtgtgtgaggagtgcggctgcacatctgagagccaggagggccacgtcctgcacctgaaggagcaccaccctgacagcccgctgctgcgcaagacctccaagaaggtggccgtggcactacagaacactgtcacttccctgctgcagggcagcccccacctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - B-cell CLL/lymphoma 7C - zinc finger protein 70 - Kruppel-like factor 11 - CNKSR family member 3 |