PTXBC044661
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC044661 |
Product type: | DNA & cDNA |
Ncbi symbol: | C10orf93 |
Origin species: | Human |
Product name: | C10orf93-chromosome 10 open reading frame 93 Gene |
Size: | 2ug |
Accessions: | BC044661 |
Gene id: | 255352 |
Gene description: | chromosome 10 open reading frame 93 |
Synonyms: | TPR repeat-containing protein C10orf93; C10orf93; C10orf123; C10orf124; C10orf92; TTC40; bA288G11.4; bA288G11.5; bB137A17.2; bB137A17.3; cilia- and flagella-associated protein 46; protein CFAP46; tetratricopeptide repeat domain 40; tetratricopeptide repeat protein 40; cilia and flagella associated protein 46 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggacctggtcatcacgcaggagctggcccgcgccgagagccagcaagatgctgcgtccttgaagaaggcctacgagttgatcaaatcggccaacctagggaaatcggagtttgacccctcagagagcttcagcccagacctgtttgttctgtgtgcagagcaggccctgaagatgaggcagccagaggtgagcgaggactgcatccaaatgtacttcaaggtgaaggcgcccatcacccagtttctgggccgagcgcacctgtgcagggcccagatgtgtgccccgaagtcggcagaaaacctggaggaatttgaaaattgcgtgactgagtacatgaaggccataaactttgccaaaggagaaccgaggtactactttttggtgtacaatgcatcagtcctctactggcagatggtgaggccgttcctcaagcctggatatcgtcaccatctgatccccagcctttcccaaatcataaacgtgctgagtcagactgaggaggaagacaaggagtggcgtgctgagctgatgctggaacttctggagtgttatctgcaagccggaagaaaggaggaggctgccaggttctgctccacggcagctccgttcattaagtctcacgtgccacagaaataccggcagatattctctgttatggtaaatcagcgtattagaaatagagacgtaagaagtaattttcttaaaagtcattgttcagaaaactgcgtagaaattacataa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - chromosome 10 open reading frame 96 - zinc finger, DHHC-type containing 24 - phosphatidic acid phosphatase type 2A - chromosome 9 open reading frame 150 |