Cart 13 Product Products 1 761,35 € (empty)
-
1 x C2orf76-ch...113,40 € -
1 x BCL7C-B-ce...113,40 € -
-
1 x C6orf208-c...113,40 € -
1 x FDC-SP...259,07 € -
-
-
1 x C19orf60-c...113,40 € -
1 x C15orf15-c...113,40 € -
1 x C3orf10-ch...113,40 € -
-
-
1 x PRKAB2-pro...121,50 €
No products
To be determined Shipping
1 761,35 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 761,35 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 761,35 €
View larger 
Data sheet of SLC25A45-solute carrier family 25, member 45 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A45-solute carrier family 25, member 45 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036869 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A45 |
| Origin species: | Human |
| Product name: | SLC25A45-solute carrier family 25, member 45 Gene |
| Size: | 2ug |
| Accessions: | BC036869 |
| Gene id: | 283130 |
| Gene description: | solute carrier family 25, member 45 |
| Synonyms: | solute carrier family 25 member 45 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtcaagatttaccgccatgagtccctcctgggcttcttcaagggaatgagcttccccattgccagcatagctgtggtcaactctgtcctgtttggggtctatagcaacaccctgctggtgctcacggccacctcccaccaggagcggcgggcccagccgcccagctacatgcacatcttcctagcgggctgcaccggggggttcctgcaggcctactgtctggctccttttgacctcatcaaagtccggctacaaaaccagacagagccaagggcccagccagggagccccccaccccggtaccaggggcccgtgcactgtgcagcctccatcttccgggaggaggggccccgggggctgttccgaggagcctgggccctgacgctgagggacacccccacggtggggatctacttcatcacctatgaagggctctgtcgccagtacacaccagaaggccagaatcccagctcagccacggtgctggtggcagggggctttgcaggcattgcttcctgggtggcagccacgcccttagacgtgatcaagtcccggatgcagatggatggactgagacgcagagtgtaccaggggatgctggactgcatggtgagcagcatccggcaggaaggactgggagtcttcttccggggggtcaccatcaacagtgcccgcgcctttcccgtcaatgctgtcaccttcctcagctacgaatatctcctccgctggtggggatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 25, member 45 - chromosome 6 open reading frame 141 - chromosome 10 open reading frame 93 - chromosome 10 open reading frame 96 |