PTXBC001227
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC001227 |
Product type: | DNA & cDNA |
Ncbi symbol: | GOLGA7 |
Origin species: | Human |
Product name: | GOLGA7-golgi autoantigen, golgin subfamily a, 7 Gene |
Size: | 2ug |
Accessions: | BC001227 |
Gene id: | 51125 |
Gene description: | golgi autoantigen, golgin subfamily a, 7 |
Synonyms: | GOLGA3AP1; GOLGA7A; HSPC041; golgin subfamily A member 7; Golgi complex-associated protein of 16kDa; golgi autoantigen, golgin subfamily a, 7; golgi complex-associated protein of 16 kDa; golgin A7 |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaggccgcagcaggcgccggtgtccggaaaggtgttcattcagcgagactacagcagtggcacacgctgccagttccagaccaagttccctgcggagctggagaaccggattgataggcagcagtttgaagaaacagttcgaactctaaataacctttatgcagaagcagagaagctcggcggccagtcatatctcgaaggttgtttggcttgtttaacagcatataccatcttcctatgcatggaaactcattatgagaaggttctgaagaaagtctccaaatacattcaagagcagaatgagaagatctatgctccacaaggcctcctcctgacagaccctattgagcgaggactgcgagtttttagattgaaattaccatttatgaagacagaggcatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - sterile alpha motif domain containing 4A - CCR4-NOT transcription complex, subunit 7 - cAMP responsive element binding protein 5 - splicing factor, arginine/serine-rich 11 |