KIF26B-kinesin family member 26B Gene

View larger

KIF26B-kinesin family member 26B Gene

Reference: PTXBC042481

Condition: New product

Print

Data sheet of KIF26B-kinesin family member 26B Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about KIF26B-kinesin family member 26B Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC042481
Product type:	DNA & cDNA
Ncbi symbol:	KIF26B
Origin species:	Human
Product name:	KIF26B-kinesin family member 26B Gene
Size:	2ug
Accessions:	BC042481
Gene id:	55083
Gene description:	kinesin family member 26B
Synonyms:	kinesin-like protein KIF26B; kinesin family member 26B
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggtgctgacgttggagcaggcagccggcagtgagcactacgacgcctcgccctgctccccgccaccgctctccaacatccccaccctggtggggtcccggcacgtgggtgggctccagcagcccagagactgggcctttgtgcccgccccctgtgccacctccaactacacaggcttcgccaacaagcacggcagcaaacccagcagccttggggtcagcaatggggcggaaaagaagagcgggtccccaacccaccaggccaaggtcagcctccagatggccaccagtccaagcaatgggaacatcctcaattcggtggccatccaggctcaccagtacctggatggcacctggtccctgtcgagaaccaacggggtcaccctgtacccataccaggactccgaagctcttgtcacacgtggcaggggccggttagaagactcggcggctgcgccagcgctgatgagcgaggacagaggagcatga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- hypothetical LOC441242 - ankyrin repeat domain 54 - kelch domain containing 9 - ankyrin repeat domain 44

Reviews

Be the first to write your review !

Buy KIF26B-kinesin family member 26B Gene now