Cart 3 Product Products 420,02 € (empty)
-
1 x RAB3IL1-RA...121,50 € -
1 x LIX1-Lix1...121,50 € -
No products
To be determined Shipping
420,02 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 420,02 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 420,02 €
View larger 
TIMM23-translocase of inner mitochondrial membrane 23 homolog (yeast) Gene
PTXBC066951
New product
Data sheet of TIMM23-translocase of inner mitochondrial membrane 23 homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIMM23-translocase of inner mitochondrial membrane 23 homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066951 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMM23 |
| Origin species: | Human |
| Product name: | TIMM23-translocase of inner mitochondrial membrane 23 homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC066951 |
| Gene id: | 10431 |
| Gene description: | translocase of inner mitochondrial membrane 23 homolog (yeast) |
| Synonyms: | Tim23; mitochondrial import inner membrane translocase subunit Tim23; translocase of inner mitochondrial membrane 23 homolog; translocase of inner mitochondrial membrane 23 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaggaggcgggggaagcggcaacaaaaccacagggggattggccggctttttcggagccggcggagcaggttactcgcacgcggatttggctggcgtcccgctaactggtatgaaccctctgtctccttatttaaatgtggatccacgatacctcgtgcaggatacagatgagtttattttacctaccggagctaataaaacccggggcagatttgagctggccttctttacgattggaggatgttgcatgacaggggctgcgtttggtgcaatgaatggtcttcggctaggattgaaggaaacccagaacatggcctggtccaaaccaagaaatgtacagattttgaatatggtgactaggcaaggggcactttgggctaatactctaggttctctggctttgctctatagtgcatttggtgtcatcattgagaaaacacgaggtgcagaagatgaccttaacacagtagcagctggaaccatgacaggcatgttgtataaatgtacaggtggtcttcgagggatagcacgaggtggtctgacaggactaacacttaccagcctctatgcactatataataactgggagcacatgaaaggctccttgctccaacagtcactctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - amine oxidase, copper containing 3 (vascular adhesion protein 1) - general transcription factor IIH, polypeptide 2, 44kDa-like - translocase of inner mitochondrial membrane 10 homolog (yeast) - mucosa associated lymphoid tissue lymphoma translocation gene 1 |