Cart 2 Product Products 558,00 € (empty)
No products
To be determined Shipping
558,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 558,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 558,00 €
Data sheet of RPL17-ribosomal protein L17 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPL17-ribosomal protein L17 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066324 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPL17 |
| Origin species: | Human |
| Product name: | RPL17-ribosomal protein L17 Gene |
| Size: | 2ug |
| Accessions: | BC066324 |
| Gene id: | 6139 |
| Gene description: | ribosomal protein L17 |
| Synonyms: | L17; PD-1; RPL23; 60S ribosomal protein L17; 60S ribosomal protein L23; gene encoding putative NFkB activating protein; ribosomal protein L17 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttcgctattcacttgacccggagaaccccacgaaatcatgcaaatcaagaggttccaatcttcgtgttcactttaagaacactcgtgaaactgctcaggccatcaagggtatgcatatacgaaaagccacgaagtatctgaaagatgtcactttacagaaacagtgtgtaccattccgacgttacaatggtggagttggcaggtgtgcgcaggccaagcaatggggctggacacaaggtcggtggcccaaaaagagtgctgaatttttgctgcacatgcttaaaaacgcagagagtaatgctgaacttaagggtttagatgtagattctctggtcattgagcatatccaagtgaacaaagcacctaagatgcgccgccggacctacagagctcgtggtcggattaacccatacatgagctctccctgccacattgagatgatccttacggaaaaggaacagattgttcctaaaccagaagaggaggttgcccagaagaaaaagatatcccagaagaaactgaagaaacaaaaacttatggcacgggagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein L13 - ribosomal protein S3A - protease, serine, 35 - hect domain and RLD 6 |