Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ATP11B-ATPase, class VI, type 11B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP11B-ATPase, class VI, type 11B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC042180 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP11B |
| Origin species: | Human |
| Product name: | ATP11B-ATPase, class VI, type 11B Gene |
| Size: | 2ug |
| Accessions: | BC042180 |
| Gene id: | 23200 |
| Gene description: | ATPase, class VI, type 11B |
| Synonyms: | P4-ATPase flippase complex alpha subunit ATP11B; ATPIF; ATPIR; ATPase IR; ATPase, class VI, type 11B; truncated ATPase 11B protein; ATPase phospholipid transporting 11B (putative) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggcgctggatccggcagcagctgggttttgacccaccacatcagagtgacacaagaaccatctacgtagccaacaggtttcctcagaatggcctttacacacctcagaaatttatagataacaggatcatttcatctaagtacactgtgtggaattttgttccaaaaaatttatttgaacagttcagaagagtggcaaacttttattttcttattatatttttggttcagcttatgattgatacacctaccagtccagttaccagtggacttccattattctttgtgataacagtaactgccataaagcagggatatgaagattggttacggcataactcagataatgaagtaaatggagctcctgtttatgttgttcgaagtggtggccttgtaaaaactagatcaaaaaacattcgggtgggtgatattgttcgaatagccaaagatgaaatttttcctgcagacttggtgcttctgtcctcagatcgactggatggttcctgtcacgttacaactgctagtttggacggagaaactaacctgaaggtttgcttgcatatgtttgagtattgctcttggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mediator complex subunit 22 - mirror-image polydactyly 1 - complement factor D (adipsin) - transmembrane protein 144 |