Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FTH1-ferritin, heavy polypeptide 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FTH1-ferritin, heavy polypeptide 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066341 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FTH1 |
| Origin species: | Human |
| Product name: | FTH1-ferritin, heavy polypeptide 1 Gene |
| Size: | 2ug |
| Accessions: | BC066341 |
| Gene id: | 2495 |
| Gene description: | ferritin, heavy polypeptide 1 |
| Synonyms: | FHC; FTH; FTHL6; HFE5; PIG15; PLIF; ferritin heavy chain; apoferritin; cell proliferation-inducing gene 15 protein; ferritin H subunit; ferritin, heavy polypeptide 1; placenta immunoregulatory factor; proliferation-inducing protein 15; ferritin heavy chain 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacgaccgcgtccacctcgcaggtgcgccagaactaccaccaggactcagaggccgccatcaaccgccagatcaacctggagctctacgcctcctacgtttacctgtccatgtcttactactttgaccgcgatgatgtggctttgaagaactttgccaaatactttcttcaccaatctcatgaggagagggaacatgctgagaaactgatgaagctgcagaaccaacgaggtggccgaatcttccttcaggatatcaaggaaccagactgtgatgactgggagagcgggcagaatgcaatggagtgtgcattacatttggaaaaaaatgtgaatcagtcactactggaactgcacaaactggccactgacaaaaatgacccccatttgtgtgacttcattgagacacattacctgaatgagcaggtgaaagccatcaaagaattgggtgaccacgtgaccaacttgcgcaagatgggagcgcccgaatctggcttggcggaatatctctttgacaagcacaccctgggagacagtgataatgaaagctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Ras homolog enriched in brain - integral membrane protein 2A - GDNF family receptor alpha 2 - integrator complex subunit 6 |