Cart 1 Product Products 121,50 € (empty)
-
1 x GCAT-glyci...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
View larger 
Data sheet of MRFAP1L1-Morf4 family associated protein 1-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRFAP1L1-Morf4 family associated protein 1-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066897 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRFAP1L1 |
| Origin species: | Human |
| Product name: | MRFAP1L1-Morf4 family associated protein 1-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC066897 |
| Gene id: | 114932 |
| Gene description: | Morf4 family associated protein 1-like 1 |
| Synonyms: | PP784; MORF4 family-associated protein 1-like 1; Morf4 family associated protein 1 like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggcccctggacatagacgaggtggaagcgcctgaggaagtggaggtgctggagcccgaggaggatttcgagcagttcctgctcccggtcatccacgagatgcgcgaggatatcgcgtctcttatacgcgagcacgggcgggcgtacctgcggaccaggagcaagctgtgggagatggacaatatgcttatccagatcaaaacgcaggtggaggcctcggaggagagcgccctcaatcacgtgcagcacccgagtggcgaagccgacgagagagtgtcggagttgtgcgagaaggctgaggagaaagccaaggagattgcgaagatggcagagatgctggtcgagctcgtctggcgaatagagagaagcgagtcttcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 3, member B - hyaluronan and proteoglycan link protein 1 - family with sequence similarity 3, member C - acyl-Coenzyme A binding domain containing 4 |