Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CHCHD2-coiled-coil-helix-coiled-coil-helix domain containing 2 Gene
PTXBC066331
New product
Data sheet of CHCHD2-coiled-coil-helix-coiled-coil-helix domain containing 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHCHD2-coiled-coil-helix-coiled-coil-helix domain containing 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066331 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHCHD2 |
| Origin species: | Human |
| Product name: | CHCHD2-coiled-coil-helix-coiled-coil-helix domain containing 2 Gene |
| Size: | 2ug |
| Accessions: | BC066331 |
| Gene id: | 51142 |
| Gene description: | coiled-coil-helix-coiled-coil-helix domain containing 2 |
| Synonyms: | C7orf17; MNRR1; NS2TP; PARK22; coiled-coil-helix-coiled-coil-helix domain-containing protein 2; 16.7kD protein; HCV NS2 trans-regulated protein; aging-associated gene 10 protein; coiled-coil-helix-coiled-coil-helix domain-containing protein 2, mitochondrial; mitochondria nuclear retrograde regulator 1; coiled-coil-helix-coiled-coil-helix domain containing 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgcgtggaagccgaagccgcacctcccgcatggcccctccggccagccgggcccctcagatgagagctgcacccaggccagcaccagtcgctcagccaccagcagcggcacccccatctgcagttggctcttctgctgctgcgccccggcagccagttctgatggcccagatggcaaccactgcagctggcgtggctgtgggctctgctgtggggcacacattgggtcacgccattactgggggcttcagtggaggaagtaatgctgagcctgcgaggcctgacatcacttaccaggagcctcagggaacccagccagcacagcagcagcagccttgcctctatgagatcaaacagtttctggagtgtgcccagaaccagggtgacatcaagctctgtgagggtttcaatgaggtgctgaaacagtgccgacttgcaaacggattggcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA (guanine-9-) methyltransferase domain containing 3 - GA binding protein transcription factor, beta subunit 1 - tumor necrosis factor receptor superfamily, member 1B - cytochrome P450, family 27, subfamily A, polypeptide 1 |