Cart 7 Product Products 1 413,91 € (empty)
-
1 x TPST1-tyro...121,50 € -
1 x PHF5A-PHD...113,40 € -
-
-
1 x Free Estriol399,00 € -
1 x SNRPE-smal...113,40 € -
1 x BUB3-buddi...121,50 €
No products
To be determined Shipping
1 413,91 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 413,91 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 413,91 €
Data sheet of RPL9-ribosomal protein L9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPL9-ribosomal protein L9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066318 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPL9 |
| Origin species: | Human |
| Product name: | RPL9-ribosomal protein L9 Gene |
| Size: | 2ug |
| Accessions: | BC066318 |
| Gene id: | 6133 |
| Gene description: | ribosomal protein L9 |
| Synonyms: | NPC-A-16; 60S ribosomal protein L9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagactattctcagcaatcagactgtcgacattccagaaaatgtcgacattactctgaagggacgcacagttatcgtgaagggccccagaggaaccctgcggagggacttcaatcacatcaatgtagaactcagccttcttggaaagaaaaaaaagaggctccgggttgacaaatggtggggtaacagaaaggaactggctaccgttcggactatttgtagtcatgtacagaacatgatcaagggtgttacactgggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacgttgttatccaggagaatgggtctcttgttgaaatccgaaatttcttgggtgaaaaatatatccgcagggttcggatgagaccaggtgttgcttgttcagtatctcaagcccagaaagatgaattaatccttgaaggaaatgacattgagcttgtttcaaattcagcggctttgattcagcaagccacaacagttaaaaacaaggatatcaggaaatttttggatggtatctatgtctctgaaaaaggaactgttcagcaggctgatgaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - histone H3-like - apolipoprotein L, 6 - ribosomal protein SA - KIAA0746 protein |