Cart 18 Product Products 2 704,96 € (empty)
-
-
1 x C6orf168-c...121,50 € -
1 x FAM122C-fa...113,40 € -
1 x MR1-major...121,50 € -
-
1 x FLJ34048-h...113,40 € -
1 x MPHOSPH6-M...113,40 € -
1 x SYP-synapt...121,50 € -
1 x FAM151B-fa...121,50 € -
-
1 x SLC48A1-so...113,40 € -
1 x MRPL44-mit...121,50 € -
1 x PSMB7-prot...121,50 € -
1 x LINCR-like...113,40 € -
-
-
1 x PTPN7-prot...121,50 € -
1 x NAPRT1-nic...121,50 €
No products
To be determined Shipping
2 704,96 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 18 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 704,96 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 704,96 €
View larger 
Data sheet of MIA3-melanoma inhibitory activity family, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MIA3-melanoma inhibitory activity family, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047116 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MIA3 |
| Origin species: | Human |
| Product name: | MIA3-melanoma inhibitory activity family, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC047116 |
| Gene id: | 375056 |
| Gene description: | melanoma inhibitory activity family, member 3 |
| Synonyms: | ARNT; D320; TANGO1; UNQ6077; melanoma inhibitory activity protein 3; C219-reactive peptide; melanoma inhibitory activity family, member 3; transport and Golgi organization protein 1; MIA family member 3, ER export factor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaaaatcaaattaagcagatgatggatgtctctcggacacagactgcaatatcggtagttgaagaggatctaaagcttttacagcttaagctaagagcctccgtgtccactaaatgtaacctggaagaccaggtaaagaaattggaagatgaccgcaactcactacaagctgccaaagctggactggaagatgaatgcaaaaccttgaggcagaaagtggagattctgaatgagctctatcagcagaaggagatggctttgcaaaagaaactgagtcaagaagagtatgaacggcaagaaagagagcacaggctgtcagctgcagatgaaaaggcagtttcggctgcagaggaagtaaaaacttacaagcggagaattgaagaaatggaggatgaattacagaagacagagcggtcatttaaaaaccagatcgctacccatgagaagaaagctcatgaaaactggctcaaagctcgtgctgcagaaagagctatagctgaagagaaaagggaagctgccaatttgagacacaaattattagaattaacacaaaagatggcaatgctgcaagaagaacctgtgattgtaaaaccaatgccaggaaaaccaaatacacaaaaccctccacggagatgtcctctgagccagaatggctcttttggcccatcccctgtgagtggtggagaatgctcccctccattgacagtggagccacccgtgagacctctctctgctactctcaatcgaagagatatgcctagaagtgaatttggatcagtggacgggcctctacctcatcctcgatggtcagctgaggcatctggggaaccctctccttctgatccaggatctggtacagctaccatgatgaacagcagctcaagaggctcttcccctaccagggtactcgatgaaggcaaggttaatatggctccaaaagggccccctcctttcccaggagtccctctcatgagcacccccatgggaggccctgtaccaccacccattcgatatggaccaccacctcagctctgcggaccttttgggcctcggccacttcctccaccctttggccctggtatgcgtccaccactaggcttaagagaatttgcaccaggcgttccaccaggaagacgggacctgcctctccaccctcggggatttttacctggacacgcaccatttagacctttaggttcacttggcccaagagagtactttattcctggtacccgattaccacccccaacccatggtccccaggaatacccaccaccacctgctgtaagagacttactgccgtcaggctctagagatgagcctccacctgcctctcagagcactagccaggactgttcacaggctttaaaacagagcccataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ARP3 actin-related protein 3 homolog (yeast) - AT rich interactive domain 3B (BRIGHT-like) - DnaJ (Hsp40) homolog, subfamily B, member 2 - vitamin D (1,25- dihydroxyvitamin D3) receptor |