Cart 3 Product Products 340,20 € (empty)
-
1 x HIST1H4A-h...113,40 € -
1 x C5orf23-ch...113,40 € -
1 x CSDC2-cold...113,40 €
No products
To be determined Shipping
340,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 340,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 340,20 €
View larger 
Data sheet of MTCH1-mitochondrial carrier homolog 1 (C. elegans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MTCH1-mitochondrial carrier homolog 1 (C. elegans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC040659 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MTCH1 |
| Origin species: | Human |
| Product name: | MTCH1-mitochondrial carrier homolog 1 (C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC040659 |
| Gene id: | 23787 |
| Gene description: | mitochondrial carrier homolog 1 (C. elegans) |
| Synonyms: | CGI-64; PIG60; PSAP; SLC25A49; mitochondrial carrier homolog 1; cell proliferation-inducing protein 60; presenilin-associated protein; solute carrier family 25, member 49; mitochondrial carrier 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatggcgggtcagggggcctggggtctggggacaacgccccgaccactgaggctcttttcgtggcactgggcgcgggcgtgacggcgctcagccatcccctgctctacgtgaagctgctcatccaggtgggtcatgagccgatgccccccacccttgggaccaatgtgctggggaggaaggtcctctatctgccgagcttcttcacctacgccaagtacatcgtgcaagtggatggtaagatagggctgttccgaggcctgagtccccggctgatgtccaacgccctctctactgtgactcggggtagcatgaagaaggttttccctccagatgagattgagcaggtttccaacaaggatgatatgaagacttccctgaagaaagttgtgaaggagacctcctacgagatgatgatgcagtgtgtgtcccgcatgttggcccaccgcctgcatgtcatctcaatgcgctgcatggtccagtttgtgggacgggaggccaagtacagtggtgtgctgagctccattgggaagattttcaaagaggaagggctgctgggattcttcgttggattaatccctcacctcctgggcgatgtggttttcttgtggggctgtaacctgctggcccacttcatcaatgcctacctggtggatgacagcgtgagtgacaccccaggggggctgggaaacgaccagaatccaggttcccagttcagccaggccctggccatccggagctataccaagttcgtgatggggattgcagtgagcatgctgacctaccccttcctgctagttggcgacctcatggctgtgaacaactgcgggctgcaagctgggctccccccttactccccagtgttcaaatcctggattcactgctggaagtacctgagtgtgcaggtgagcaagcactggacggcggaggcctttcctgttctttgctacatccttcagctgaaatggttttgtggatgcttcattgcatgcaaagataagtggtttcatggaattcaatattgtgaggagatacttggtatctataaggcatttaagttttcatcttacataatttcagaaaggatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - melanoma inhibitory activity family, member 3 - ARP3 actin-related protein 3 homolog (yeast) - AT rich interactive domain 3B (BRIGHT-like) - DnaJ (Hsp40) homolog, subfamily B, member 2 |