Cart 1 Product Products 115,24 € (empty)
No products
To be determined Shipping
115,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 115,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 115,24 €
View larger 
P2RX5-purinergic receptor P2X, ligand-gated ion channel, 5 Gene
PTXBC039015
New product
Data sheet of P2RX5-purinergic receptor P2X, ligand-gated ion channel, 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about P2RX5-purinergic receptor P2X, ligand-gated ion channel, 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC039015 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | P2RX5 |
| Origin species: | Human |
| Product name: | P2RX5-purinergic receptor P2X, ligand-gated ion channel, 5 Gene |
| Size: | 2ug |
| Accessions: | BC039015 |
| Gene id: | 5026 |
| Gene description: | purinergic receptor P2X, ligand-gated ion channel, 5 |
| Synonyms: | LRH-1; P2X5; P2X5R; P2X purinoceptor 5; ATP receptor subunit; ionotropic ATP receptor P2X5; lymphoid-restricted histocompatibility antigen-1; purinergic receptor P2X, ligand gated ion channel, 5; purinergic receptor P2X 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggcaggcgggctgcaaggggctctgcctgtcgctgttcgactacaagaccgagaagtatgtcatcgccaagaacaagaaggtgggcctgctgtaccggctgctgcaggcctccatcctggcgtacctggtcgtatgggtgttcctgataaagaagggttaccaagacgtcgacacctccctgcagagtgctgtcatcaccaaagtcaagggcgtggccttcaccaacacctcggatcttgggcagcggatctgggatgtcgccgactacgtcattccagcccagggagagaacgtcttttttgtggtcaccaacctgattgtgacccccaaccagcggcagaacgtctgtgctgagaatgaaggcattcctgatggcgcgtgctccaaggacagcgactgccacgctggggaagcggttacagctggaaacggagtgaagaccggccgctgcctgcggagagagaacttggccaggggcacctgtgagatctttgcctggtgcccgttggagacaagctccaggccggaggagccattcctgaaggaggccgaagacttcaccattttcataaagaaccacatccgtttccccaaattcaacttctccaaaagcaatgtgatggacgtcaaggacagatctttcctgaaatcatgccactttggccccaagaaccactactgccccatcttccgactgggctccgtgatccgctgggccgggagcgacttccaggatatagccctggagggtggcgtgataggaattaatattgaatggaactgtgatcttgataaagctgcctctgagtgccaccctcactattcttttagccgtctggacaataaactttcaaagtctgtctcctccgggtacaacttcagatttgccagatattaccgagacgcagccggggtggagttccgcaccctgatgaaagcctacgggatccgctttgacgtgatggtgaacggcaagggtgctttcttctgcgacctggtactcatctacctcatcaaaaagagagagttttaccgtgacaagaagtacgaggaagtgaggggcctagaagacagttcccaggaggccgaggacgaggcatcggggctggggctatctgagcagctcacatctgggccagggctgctggggatgccggagcagcaggagctgcaggagccacccgaggcgaagcgtggaagcagcagtcagaaggggaacggatctgtgtgcccacagctcctggagccccacaggagcacgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - janus kinase and microtubule interacting protein 1 - purinergic receptor P2X, ligand-gated ion channel, 1 - glutamyl-tRNA synthetase 2, mitochondrial (putative) - vacuolar protein sorting 4 homolog B (S. cerevisiae) |