Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NKAIN4-Na+/K+ transporting ATPase interacting 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NKAIN4-Na+/K+ transporting ATPase interacting 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC041812 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NKAIN4 |
| Origin species: | Human |
| Product name: | NKAIN4-Na+/K+ transporting ATPase interacting 4 Gene |
| Size: | 2ug |
| Accessions: | BC041812 |
| Gene id: | 128414 |
| Gene description: | Na+/K+ transporting ATPase interacting 4 |
| Synonyms: | C20orf58; FAM77A; bA261N11.2; sodium/potassium-transporting ATPase subunit beta-1-interacting protein 4; Na(+)/K(+)-transporting ATPase subunit beta-1-interacting protein 4; Na+/K+ transporting ATPase interacting 4; Sodium/potassium transporting ATPase interacting 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggctcctgctccggccgctgcgcgctcgtcgtcctctgcgcttttcagctggtcgccgccctggagaggcaggtgtttgacttcctgggctaccagtgggcgcccatcctggccaactttgtccacatcatcatcgtcatcctgggactcttcggcaccatccagtaccggctgcgctatgtcatggtgtacacgctgtgggcagccgtctgggtcacctggaacgtcttcatcatctgcttctacctggaagtcggtggcctcttaaaggacagcgagctactgaccttcagcctctcccggcatcgctcctggtggcgtgagcgctggccaggctgtctgcatgaggaggtgccagcagtgggcctcggggccccccatggccaggccctggtgtcaggtgctggctgtgccctggagcccagctatgtggaggccctacacagttgcctgcagatcctgatcgcgcttctgggctttgtctgtggctgccaggtggtcagcgtgtttacggatgaagaggacagctttgatttcattggtggatttgatccatttcctctctaccatgtcaatgaaaagccatccagtctcttgtccaagcaggtgtacttgcctgcgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger and BTB domain containing 44 - DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 - aspartyl-tRNA synthetase 2, mitochondrial - amine oxidase (flavin containing) domain 2 |