PTXBC060858
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC060858 |
Product type: | DNA & cDNA |
Ncbi symbol: | SOCS3 |
Origin species: | Human |
Product name: | SOCS3-suppressor of cytokine signaling 3 Gene |
Size: | 2ug |
Accessions: | BC060858 |
Gene id: | 9021 |
Gene description: | suppressor of cytokine signaling 3 |
Synonyms: | ATOD4; CIS3; Cish3; SOCS-3; SSI-3; SSI3; suppressor of cytokine signaling 3; STAT-induced STAT inhibitor 3; cytokine-inducible SH2 protein 3 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggtcacccacagcaagtttcccgccgccgggatgagccgccccctggacaccagcctgcgcctcaagaccttcagctccaagagcgagtaccagctggtggtgaacgcagtgcgcaagctgcaggagagcggcttctactggagcgcagtgaccggcggcgaggcgaacctgctgctcagtgccgagcccgccggcacctttctgatccgcgacagctcggaccagcgccacttcttcacgctcagcgtcaagacccagtctgggaccaagaacctgcgcatccagtgtgaggggggcagcttctctctgcagagcgatccccggagcacgcagcccgtgccccgcttcgactgcgtgctcaagctggtgcaccactacatgccgccccctggagccccctccttcccctcgccacctactgaaccctcctccgaggtgcccgagcagccgtctgcccagccactccctgggagtccccccagaagagcctattacatctactccgggggcgagaagatccccctggtgttgagccggcccctctcctccaacgtggccactcttcagcatctctgtcggaagaccgtcaacggccacctggactcctatgagaaagtcacccagctgccggggcccattcgggagttcctggaccagtacgatgccccgctttaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - cholinergic receptor, muscarinic 5 - leucine rich repeat containing 4C - diaphanous homolog 3 (Drosophila) - RasGEF domain family, member 1C |